| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGAGCAUUCUCAGCACAUUGCCUCAACAGCUUCAAGGUGAGCCAGCU… | 836 nt | 0.4115 | |
| AGUGAGCAUUCUCAGCACAUUGCCUCAACAGCUUCAAGGUGAGCCAGCU… | 780 nt | 0.4038 |
This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators that are involved in a wide variety of cellular activities such as embryonic development, homeostasis and tumorigenesis. The protein encoded by this gene is able to reduce the release of pro-apoptotic cytochrome c from mitochondria and block caspase activation. This gene is a direct transcription target of NF-kappa B in response to inflammatory mediators, and is up-regulated by different extracellular signals, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), CD40, phorbol ester and inflammatory cytokine TNF and IL-1, which suggests a cytoprotective function that is essential for lymphocyte activation as well as cell survival. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
A study in humans using bulk and single-cell RNA sequencing of peripheral blood mononuclear cells from ICU patients identified the BCL2A1 as significantly upregulated in sepsis patients, predominantly in monocyte/macrophage and neutrophil clusters [Li et al. DOI:10.3389/fpubh.2022.937303]. A study in mice demonstrated that the BCL2A1 (BCL2A1) is an early-response gene induced during lethal and non-lethal *E. coli*-induced sepsis, and its expression was validated as upregulated in human sepsis cohorts [Zhang et al. DOI:10.1093/jimmun/vkaf140].