Basic Information

Symbol
BCL2A1
RNA class
mRNA
Alias
BCL2 Related Protein A1 BCL2L5 BFL1 GRS ACC-1 ACC-2 HBPA1 ACC2 ACC1 Hemopoietic-Specific Early Response Protein Bcl-2-Related Protein A1 Bcl-2-Like Protein 5 Protein BFL-1 Bcl2-L-5 Hematopoietic BCL2-Related Protein A1 Protein GRS
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_004049.4
Sequence length
780.0 nt
GC content
0.4038

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-187.60 kcal/mol
Thermodynamic ensemble
Free energy: -205.61 kcal/mol
Frequency: 0.0000
Diversity: 168.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((....))))......((((((..(((((((....((((((((((((....((((((........))))))...)))....((((((((........)))))))))))))))))......(((((((((....((((.((...((((((...(((...(((((((((..((...(((...((.(((...))).))(((((...((((........))))..))))))))..))..)))))))))...)))...)))))))).)))).))))).)))).((((.........))))........)))).)))..)).))))((((((..((((((((((((....(((((...((.((.((((((...(((((((((.........((.((((((.........((((((((..(((...)))....))))))))))))))))..(((((...))))).....(((((.(((.....(((((..((.(((((((......((((((.....))))))....(((...((((((((((.......)))))..(((.(((((.((((..((.....)).)))).))))).)))...........))))).))).(((........)))...)))))))....(((((.........))))))).)))))....))).))))).................)))))))).).......)))))).)).))))))).)))))).))))))..))))))........................
Thermodynamic Ensemble Prediction
.,((((....}}},,}.,,.((((((..(((((((....((((((((({{{...,((((((........)))))).,.}}}....((((((((........)))))))))))))))))......(((((((((..{.((((.((,,,{(((((...(({...(((((((((..((...((((.,((.(({...})).))|{(({...((((........))))..}))}))))..))..)))))))))...)))...)))))))).))))})))))},))).,,((,..,.....,,}),}}}....))))))})..)).))))((((((.,(((((({((({{....(((((...({.((,((((((...,((((((((,,,,,{{{.(({{((({...,,,...{((((((((..(({...}))....}})))))}||}}||.|,,{((({...})))}..,..{((((.{((.....(((({..{{.(((((((...,,,,|({{|....,)}}))},...(({...((((((((({.,,,,,,}}}}),,|||,(((((.((((..((.....)).)))).))))).|||{....,},}..))))).))).(((........)))...))))))}...,{{((,.........)))}}}}.)))))....))).))))).................}))))))).).......)))))),))}))))))).}))))).)))))).,))))))........................

Transcripts

ID Sequence Length GC content
AGUGAGCAUUCUCAGCACAUUGCCUCAACAGCUUCAAGGUGAGCCAGCU… 836 nt 0.4115
AGUGAGCAUUCUCAGCACAUUGCCUCAACAGCUUCAAGGUGAGCCAGCU… 780 nt 0.4038
Summary

This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators that are involved in a wide variety of cellular activities such as embryonic development, homeostasis and tumorigenesis. The protein encoded by this gene is able to reduce the release of pro-apoptotic cytochrome c from mitochondria and block caspase activation. This gene is a direct transcription target of NF-kappa B in response to inflammatory mediators, and is up-regulated by different extracellular signals, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), CD40, phorbol ester and inflammatory cytokine TNF and IL-1, which suggests a cytoprotective function that is essential for lymphocyte activation as well as cell survival. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans using bulk and single-cell RNA sequencing of peripheral blood mononuclear cells from ICU patients identified the BCL2A1 as significantly upregulated in sepsis patients, predominantly in monocyte/macrophage and neutrophil clusters [Li et al. DOI:10.3389/fpubh.2022.937303]. A study in mice demonstrated that the BCL2A1 (BCL2A1) is an early-response gene induced during lethal and non-lethal *E. coli*-induced sepsis, and its expression was validated as upregulated in human sepsis cohorts [Zhang et al. DOI:10.1093/jimmun/vkaf140].