| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCCAGUUUCUCCGUCAGCCUGCGGGUCCCGGCUGGCGGCUGCUUCCGGU… | 3034 nt | 0.4031 |
Predicted to enable SNAP receptor activity and SNARE binding activity. Involved in autophagosome assembly; cholesterol efflux; and protein stabilization. Located in several cellular components, including BLOC-1 complex; phagocytic vesicle; and phagophore assembly site. Part of SNARE complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in rats demonstrated that cortical gene expression differences exist between ethanol-preferring and nonpreferring strains, with quantitative RT-PCR confirming significant mRNA up-regulation of VAMP2, STX1a, STX1b, MUNC-18, and cacna2d1, and down-regulation of mGluR3 in AA versus ANA lines [Worst et al. DOI:10.1002/Jnr.20496].