| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCCUACCCUGUGCCGCAGCCGCAUCGCCACCGCAGCCCGGCAGAGCCG… | 4674 nt | 0.5911 |
The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. [provided by RefSeq, Jan 2015]
A study in rats demonstrated that the STX1B mRNA was significantly up-regulated by 30% in the frontal cortex of ethanol-preferring AA rats compared to ethanol-avoiding ANA rats, as confirmed by quantitative RT-PCR [Worst et al. DOI:10.1002/Jnr.20496].