| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCGGUCCCUAGCGCGGCUGCGGGGCGGAGAGCUGCGGCUGGCCCAGC… | 3772 nt | 0.5148 | |
| AGUCGGUCCCUAGCGCGGCUGCGGGGCGGAGAGCUGCGGCUGGCCCAGC… | 3880 nt | 0.5180 |
This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
A study in mice demonstrated that a running exercise intervention significantly shortened methamphetamine-induced conditioned place preference from 6 to 3 days and identified 12 differentially expressed genes in the hippocampus, including the STXBP1 which was downregulated in the exercised, methamphetamine-addicted group [Li et al. DOI:10.21037/atm-22-450]. A study in mice demonstrated that a running exercise intervention significantly shortened methamphetamine-induced conditioned place preference and identified 12 differentially expressed genes in the hippocampus, including the STXBP1 which was down-regulated in the METH-addicted group receiving exercise [Li et al. DOI:10.21037/Atm-22-450]. In rats, research on ethanol-naive, genetically selected lines found the STXBP1 mRNA was up-regulated in the frontal cortex of alcohol-preferring AA rats compared to alcohol-avoiding ANA rats, a finding confirmed by quantitative RT-PCR [Worst et al. DOI:10.1002/Jnr.20496].