| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAAUGGCGGCCUCCAUGUUCUACGGCAGGCUAGUGGCCGUGGCCACC… | 2111 nt | 0.3837 |
Succinyl-CoA synthetase (SCS) is a mitochondrial matrix enzyme that acts as a heterodimer, being composed of an invariant alpha subunit and a substrate-specific beta subunit. The protein encoded by this gene is an ATP-specific SCS beta subunit that dimerizes with the SCS alpha subunit to form SCS-A, an essential component of the tricarboxylic acid cycle. SCS-A hydrolyzes ATP to convert succinate to succinyl-CoA. Defects in this gene are a cause of myopathic mitochondrial DNA depletion syndrome. A pseudogene of this gene has been found on chromosome 6. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.