| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUUGCUACGUUCAGAUCAAACCUUGAACUUUUUUUUUUCUGGUGCCAG… | 7018 nt | 0.3668 |
Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. However, the total genomic length of this gene is greater than that of other SULT1 genes. [provided by RefSeq, Jul 2008]
A study in humans identified the SULT1B1 as a diagnostic gene marker upregulated in sepsis, with its expression validated in clinical blood samples [Chen et al. DOI:10.3389/fimmu.2025.1638156].