| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGUGGUUCUCAUCUUUUUUUGCAGCUUAAGAUCUGCCUUGGUAUUU… | 1773 nt | 0.3683 |
Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that transfers a sulfo moiety to and from estrone, which may control levels of estrogen receptors. [provided by RefSeq, Jul 2008] CIViC Summary for SULT1E1 Gene
A study in porcine skin demonstrated that the SULT1E1 transcript was significantly decreased in all four bromine-exposed experimental groups (45 s and 8 min exposures at 24 h and 7 d post-exposure) and was involved in the xenobiotic metabolism signaling pathway [Price et al. DOI:10.1016/j.toxlet.2008.08.007].