Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCUCCAGCGGUGGCUACAGUUGAAACCCUCACACCACGCAGGAAGAG… | 1904 nt | 0.4354 |
Summary
This gene encodes a member of the sulfotransferase family. Sulfotransferases aid in the metabolism of drugs and endogenous compounds by converting these substances into more hydrophilic water-soluble sulfate conjugates that can be easily excreted. This protein catalyzes the sulfation of steroids and bile acids in the liver and adrenal glands, and may have a role in the inherited adrenal androgen excess in women with polycystic ovary syndrome. [provided by RefSeq, Mar 2010]
Forensic Context
A study in human prostate tissue demonstrated that the SULT2A1 mRNA is downregulated in samples with a late ischemic time (>1000 minutes) compared to an early ischemic time (<150 minutes) in an independent validation cohort from the GTEx database [Javan et al. DOI:10.1038/s41598-025-29561-7]. This downregulation was part of a broader transcriptional signature associated with prolonged postmortem intervals, where the SULT2A1 was identified alongside other genes involved in heparan sulfate biosynthesis.