| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCCGGAUCGCCCAGCUCCGCGUUAGCCGGAGCUGCACGCGGGGCUGCC… | 12651 nt | 0.4422 |
This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]
A study in rats demonstrated that the SV2B was less abundant in spinal cord tissue until 7 days post-contusion, then showed increased expression specifically at the injury epicenter at 35 days post-injury [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042].