Basic Information

Symbol
SV2B
RNA class
mRNA
Alias
Synaptic Vesicle Glycoprotein 2B KIAA0735 HsT19680 SLC22B2 Solute Carrier Family 22 Member B2 Synaptic Vesicle Protein 2B Homolog
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_001323032.3
Sequence length
12563.0 nt
GC content
0.4413

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3881.40 kcal/mol
Thermodynamic ensemble
Free energy: -4126.42 kcal/mol
Frequency: 0.0000
Diversity: 3216.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((......(((((((((((((((....)))).)))))))))))))))((((((((((((.(((((((.(((((..(((....)))..)))))(((((.((..(((((((.((((((((((((((((....(((((.........)))))....))))))).)))...((((........)))).((((......))))........(((((.........(((((..((((((.(((..(((((((.((.(((...))).))..................((((((..(((((.......)))))))))))...)))))))..))).))))))..)))))..)))))...((((((((((.......)))))))))).....(((((((......((((((((.....))).)))))..)))))))........((((.....)))))))))).))).))))..))))))).)))))))..(((((((((.....))).......(((..((((((.((.....((((((..((((((((((((((((.......(((((((((.(((((((((((........(((((((....((((.((((((((((.((((.(((((..(((((.....(((((((((((..((((.......))))((((((((.(((((((.....))))......((((.((((((.(((((..(((.((((((((((((...((.(((((..(((((((((((((.((....((...((((((((((...((.((...)).))..)).))).)))))..))))))))))).....))))))..)))))..)))))))))))))).)))......(((((((((.((((((.((((....((((((((.((((.......(((((......))))).(((((......)))))....((((((((..(((((((((.((((...((((((.(((((((((.(((((((((((((....))))))((((((.(((.(.(.((((.......))))..).)..))).)))))))))))))((((((((((((.(((((((((((((((...(((((..((((((.((......))..))))))..))))).)))))).....)))))))))).....((((((.........)))))))))).)))))))....(((((....)))))........))))))..))).))))))...))).).))).))..))))..)))))))).))))..))).))))))))).)))))).))...)).))))))))))..)))))).))))))).)))))))))))))).))))).((((((((((...((((((......(((((.........((((.(((((..((.(((((((((......((((((((((((((((.(((((.(((...((((((.......)))).)))))..(((...))).)))))..)))))).))))))....)))).....))))...(((((((((..((((((..((.....((((((.((((((((....((((((....))))))...((((.(((((...........))))).))))...(((((((........)))))))....((((((.(......).))))))((((((((.......))))))))..((((((......))))))......)).))))))...)))...)))....))..))))))((((((.(((((.......((((((((.((((((....((((........))))(((........)))(((........))).(((...)))....(((((((((.....))))))))).((((.(((((((...((((((.(((((((.....))))))).))))))...)))))))))))..)))))).))))))))..(((((...........))))).....((((((((((((...((((((....(((..((((((((.....(((.(((............(((((((........)))))))..))))))))))))))((((((((.(((((....(((((.......))))).(((((((((((.....))).....))))))))..))))))))....)))))(((((((((...((((.((((....(((((((((((((((.....(((..(((((.((((((.((...((........)).)))))).)).)))))..))).(((((.((((((.(((((....))))).))))))))))).(((.(..(((((...((.(((((..(((.((((..(((.((((((((((((((.(((((...((...((((((((((....(((((..(((.(((......))...).)))..)))))....))))))))))...))...((((...))))......))))).))).)))))))))))))).(((......))).(((((((.....))..))))).)))).)))...))))).)).(((........)))...((.(((((...))))).))((....))(((((((((((...((((((((((......((((...))))....(((((.....((((((((((((((((((((((((((((((.((((....(((((.((.((.(((.....))))).)).))))).)))).))))))))...(((((.....)))))...)))))))........))))))))...))))))).))))))))))))))).)))).((((.((.((((....))))..))..))))...)))))))......(((((((((((.......)))))))))))..(((((((...((((.......)))).))))))))))))..).))).))))))).....................(((((((.....((((((((....((((((((((((((((.(((.((((((((...((((((.((((.(((((((((((((((.....)))))).(((((((.((.(..(.((((.(((((...((((..(((((....))).))....))))))))))))).)..).)).))))))).....((....))))))....))))).)))).)))))))))))))).)))(((((((((............)))))))))..(((.(((((..((((((.....((((((((.....(((((((((.((..(((((.....((((.((((.(((((...(((((...(((..(((.....)))..))).)))))))))))))).)))).....)))))..)))))))))))))))))))........)))))).....))))).)))...((((((..(((.((((..((((((((((.(((...))).))))((..((((........)))).))....)))))).)))).)))))))))...(((((.....)))))....)))))))))..)))))))(((.(((((........))))).)))...........(((((((.((((((((.(((.((((((((((.((...((((((........((((.(((((((((((((((((((((((.(((....))).))))))((((((.(((....))))))))).((((((((.....(((....)))((((.((.....))))))((.((.((..(((((....)).)))..)).)).))...(((((......)))))))))))))(.(((((((((((.((.(((((((.(.(((.(((((((((((((.((((..(((((((.(((((...(((((...)))))))))).....(((((((((((((((((((((((....(((((..(((((.(.(((..(((((.....((((....))))))))).))).).))))).....(((.(((((((((((((..((((((((...(((((......((..(((((((((((((((......))))).))(((((..(((....))).))))).........((((.(((((..((.(((((((((((.....)))))..(((((.........)))))(((((.(((........................(((((((((((((((((.(((.......))))))))))).)))......))))))...))).))))).)))))).))..))))).))))..))))))))..))....)))))....))))))))..)))......))).))))))).))).......)))))...)))))))).)))))))..............))))))))...)))))))..))))..)))))).)))))))))).)))).)))).)).))))))))))).).((((((((......)))))))).))))))))))))))........((((((.(((...))).)))))).(((....)))....))).))))....(((((((......((((...(((((((...........))))))))))).(((((((((..((((((.....))..........(((((.....))))))))).))))))))).....)))))))((((((((......((((((.(.......))))))).......))))).))).)))))).((((((....))))))..))..))))))))))))).)))).))))..(((((((((((......))))))))))).)))))))...............)))))))).....)))))))....)))))))).))))..))))..))).))))))..))))))))))))))))))))).(((...)))((((((.(((((.(((((((((((((((((.....))))))).........((((.(((..(((((((((((...................)))))...))))))....))).)).))(((...((((((((((((.(((..........(((.((..(((..((((((((.(..((((.((((..((....(((((((.(((((((((..(((.....((((((((((..(((((..(((((....((.(((.....))).))....))).))..))))))))))...(((((((......).))))))....(((((...((((((((..(((((((((..(((((((......)))))))((((((.((((((..........(((((..(((((.(((....))).))))))))))..(((((((((.((((((........)))))).))(((((......)))))..............((.((((.....)))).))..))))))).((((....)))))))))).....))))))........)))))..)))))))))))).))))))))))..)))..))).)))))).))))))).....)).)))).))))))))).).)))..))))).)))(((((..((((((...))))))....)))))).)).))))...)).))))))..))))))))))))).))))).))))))((((((((((((((...(((.....))).)).)))))))))))).......(((((...(((((((.((((.....))))...))).))))...)))))............))))).))))))...)))))))))...................((((.((((.......)))))))).))))))).))))).)))).........)))))......))))))...((((((((((((((((..(((((.((((((..((((((..(((...((.(((..((.....))...))).)))))..))))))..))))))(((((........)))))...(((((..........)).))).))))).....(((..((((((((((.((................))))))).)))))..))).(((((((........((((((((........))))))))..(((((((..(((((..((........................))..)))))...)))))))))))))))))).)))))).)).))))))))).)))))...((((.......)))).....(((.....))).)))))..))))).))))))))))))...)).)))))))))))........)))))......))))))..))).)).))))...............(((((((.(((....))).)))))))..((((((.((((((......)))))).))))))((.((((((((.((((((...(((((((((.((..(((((..(((((....))))).......)))))..)).))).)))))).....))))......(((((....)))))((((......))))))...)))))))).))(((((((.(((((....)))))...))..))))).(((((....)))))...)))..))))))))))))).))))))..))))))))..)))((((....)))))))))).((((((..((((((..........((((((((((..(((((....)))))......)))))..)))))...))))))......)))))).(((((((.(((((((.(((((.......(((((....)))))...(((((((.(((((((............(((((((....(((((.............)))))...)))))))............))))))).)))))))((.(..(((((((((.((((.(((((((((.(((((((...((......)).))))))).)).......))))))).))))(((((..((((((..((((((((.((((((((...........((((((((.((((((((...........)))))))).))))))))...........)))))))).))))))))((.((.......)).))......))))))..)))))((((((((((((((.(((.....(((.(..(.((((((((.(.((.(((......(.((((((((.......)))))))))))).))))))))..))).)..).)))..(((...)))..))))))).)))))))))).)))))))))..)))...))))))))))))))))))).)))).)).))).)))((((...(((((.(.((((((.((((.(..((.(.....((((((...((((((((((((.........)))))..((((((...........))))))...(((..((((..((((((((.((((((.....(((((((((....(((((........((((((((..((.((((((.(((((((.(((((((..(((((((((...))))))))).))))))))))))))))))))...))....))))))))........)))))....))).))))..........)).....)))))).))))))))))))..)))....((((((..(((((.(((((((((((......)).))))))))).)))))))).))).........((.((((.......(((((((((...((((..(((((.......(((((....(((((..((((((.(((((((((((((.((......((((.((((((((.....((((.(((((((((....))))))(((((((((((((((....((((....))))))..)))))))))).))).....(((((((.((((((((((.(((((((......)))))))...))))))))))..)))...))))...))).)))))))))))).)))).....((((((((.(((..(...(((((((((...)))))))))...).))).))))))))((((((((....))))..(((((.(((((......((((......))))....(((.....)))......)))))...)))))..)))).(((((.((..((((((.((......)).))))))......)).)))))..((((((.......)))))).....((((((((...............))))).)))..)).))))))......)))))))))))))))))).....)))))..(((((.........))))).......(((((((((((...(((.((((.((.((((((((....((((((.....))))))...............(((((.......))))).))))))))))))))...))).....))))))))))))))))...))))....))).)))))))))))).)))))))......((((((((((((((((((((((((...((((...(((((((.........((((((((.(..((((.((((((..((((.(((((.(((....))).)))))..)))).......((((..(((...)))...))))...(.(((((((....))))))).).....(((.....)))..(((....))))))).)).))))..).))))))))..(((((.((....)).)))))............((((((((.(.....(((((((((((((.((((((..(((((((((((.((((((.((((((((((((((((((((...))))))....)))))))....))))))).((((.....)))))))))).))).......((((((((.((((((.......)))))).).)))))))..(((.(((((.............(((.((((.(.(((((....))))).).)))).)))...........))))).)))..)))))))).........))))))......(((((...........((.(((((((((((((..(((..(((((((((....)))))...((((.....))))((((((.(((((((((((((......))))))))))))).))))))))))..)))..)))...............)))))))))).))...............)))))..(((((............))))).........))))))).)))))).....((((((....((((((...((((((......(((..((((.((((.(((((((((.................)))))))))....(((((((...(((..................((......))(((((............)))))(((((((.......(((((((......((((((.....(((......)))))))))....((((((..........)))))))))))))....))))))).)))..)))))))........)))).))))..))))))))).))))))....(((((((........)))))))(((((((((((..((....))..))))))))))))))))).........).)))))))))))))))...)))))))))))))))))........))))))))))).((((((((...)))))))).....((.(((((((((((((.((.......))))))))))..))))))))))))).....).))..).))))......)))))))..))))).))))...((((((((......))))))))(((((...........))))).(((.((((...((((..((..(((((((.(((...)))...))))))).)).))))....)))).))).))..((((((((((((((((((((..(((((((((((.(((((((((((((.((((...............((.((((((((..((.(((((.(((((...(((((((((....((((((.((...(((((((......)))))))..))..))))))......((((.((((..(((((((....))))).))..))))))))((((((.(((((...((((........))))....)))))(((((((........))))))).((((.(((.((((...))))))).))))...........)))))).......((((((((((.(.(((((((((((......))))))))))).)...))))))))))...((.((((((((((.....((....(((......)))..)).....)))))))))).))..)))))))))...)))))((((((((((((((((.(.....(((.....))).....).))))))).)))))))))((((....((((((.........))))))....))))..((((((((((((((.((((.......(((((....))))).........)))).)))).((((..(((((((...)))))))..))))..(((((((...((((((((....(((((....)))))((((((.(((.........(((((((((((((.((.((((((((....))))).))).)).)))....)))))))))))))))))))((((.............))))(((....)))...((((.(((.(((((..(((.(((((((.(((((((((((...(((((.((((.((((((.(.((((((((.(......).))).))))))))).)))..)))).))))).......(((.(((....((....))..)))))).)))))))).(((.((..((((........)))).)))))..((((....((((.(((....))).))))...))))(((((((((.(((.......)))))))))).))..))).))))))).)))..)))))))).)))).))))))))..))))))).......((((((((.(((..((((((((.(.((((((((.((..((((((((.(.((.....(((...(((((((.((((((((((..........((((((.....))))))))))))).....((((((..(((.(((((((.((((((.......(((((((......))))))).((.(((..((((((((..((..(((......)))..)).)))).)))).))).)).((((((((..(((((.....)))))......))))))))....(((.((((((((((((((..(((((((.....)))))...))..)))))))))...))))).)))........))))))((((((......))))))(((((((((((((..((..((((((.((((((((((...............)))))).))))....))))))..))....))))))))).)))).............((((((.((((((((.((.(((.((.....((........)).....))))).)).)))))....))).))))))........))))))).)))...))))))..((((((((........)).))))))...((((((........))))))...))).)))))))..)))(((((((...(((......)))...))).))))...((.(((((((((..(((((((((.(((((.......))))).)))))))))....)))))))))..)).((((((((..((((.(((((((.((((((.((.((.(((((...((((..((((((((.((.....)).))))))))....))))...)))))..))...))))))))(((((((((((((((....(....).....)))))))))))))))...(((....)))..(((((((...))))))))))))))....))))..........))))))))((((((.(((...((((.(((........(((((.((((((...)))))).)))))((((....))))..............(((((.(((.....))))))))...((((.((..(((((((..((((((........(((((((((.((((.((((((((((.((((.((((...)))))).)).)))).......)))))).))))...)).)))))))..(((.......)))..(((..(((..((.(((((....((((...(((((((((....)))))))))...))))......))))).))..)))..)))))))))..)))))))..)).))))((((....)))).........((((....))))...)))))))...)))))))))..)).).)))).))))....)).)))))))).)))))))))..)))..)))))))).((((.....))))(((((.(((....))).)))))......))))))))))))))).))..)))))))).))....))))...)))).))))))))).)))))))))))..))))))))))))))))))))
Thermodynamic Ensemble Prediction
...,,...(((.(((((((((....)},)))))))...)))|(((((..,(((((((((((.(((((((((.(((((..(((....)))..)))))(((((.((..(((((((.((((((((((((((((....(((((.........)))))....))))))).))),,,((((........)))).{|||......}},,........{((((.........{((((..((((((.(((..(((((((,,{,({....,}}.}}..........,.......((((({.,(((((.......)))))))))))...)))))))..))).))))))..))))),,)))),.,,{(((((((((,......))))))))))|....,,,{(({.,,.,,,,,,,||,..,,.}}}.}||||{{.,,,)))))}.....((((.....)))))))))).))).))))..)))))))...(((((..(((((((.........((({,({...}})))).{{.{.{(({(((((((...))))))).}))),,)}.(((((((((((.....((((.((((......(((((((...))).))))....,,(.(((.(((((((((((.(.(((((((,,(((((.,..{{{((((..,.{{{|,||,,,{,..{((..((((.....))))..,,},||}||||((({..{...(((((.(((((.,,.......))))}.)))))..},,)))},...,|.||{||.,||||||{{{,,...{{.||.,,)).)),.)),)}).)))),,,))})))))),))))))))))))))))))).))).)||((((.....)))),,)))).))))..))}}))))))))))))))).)))))))).))))))..(((((......))))).(((((......)))))((((((({{..(((.((((((((((.(((.((.((((((,{{...((((((((((((((((....)))))))..,...{{({{((((((.((((((((((...(((((.((((.((((((,((((((,{,,,,,,.|.|,|||||..{(((((..,((({{..((((((.,{......|}..}))))}..))))).))))))..,,.,,,,{{({({{{({{,((({..{{(((((((((((((({{{((((......)))).}}}..((((((((.((((((((,.(((.((({,.((.((((((((((((({..((({....,.||||,..}}}}))},{{{{(((((((((((((.........,..||)))).))))))).(({(({(({,{{.{((((({...{({{{|{{(((({{..|{||||({{({,,,{{((,{{{{{({{{{(({..|||||||||,.}}},||}}}...,,{{,{{{{||||(({{,.{||||.,||..,{{((((.......)))).}||||..((({.{|||{|,|||,,,||||}.}|}}}}...,}},,.....,|||......{{({(,{,,{,.,,{.,|.|}|,,||||,.,,,|||}((({.((((((....))))))}}}{|||.,{{{{.....,,.,,,|}}||{||,,...(((((((.|.....})))))))....((((((.(......).))))))((((((((.......))))))))..,{{(((...{{{||||||{{{{|||||||,,||,,.,||,,,,.,.{{{({{...}}}}}},,,,...|{.....,||(({(({{{.{(((((.,,.{(((......,.}}},,,{........},|{{{........}))}{{|...}))....(((((((((.....))))))))).((((.(((((((...((((((.(((((((.....))))))).))))))...)))))))))))..}}}}}}.})))))}}.,,||,....,{||{....|||......,,,,...,,,,....}}}}.....,|{||,,..)))),,||}|}||}||}}}}}.,.,{((({{{{{{{|{.((((((((((,{.((((.(((((..{{((,(({,((..,{{,....(((((.......))))).{(((((((,((.,...,,).,,..))))))))..,,,,,,,{((((((.(((.((.(((({..(({.,((((..((((((((((((((((..{{..{{{..{((((.{{{{{(,,,.,.{(,,,.....)).}})))},}).}}}||,,|||{(((({{((((((.(((((....))))).))))))))))).(({.((((((.(({..((((((((.((((((((.(((((((((((((((((((.(((((...((...((((((((((....(((((..(((.{((,...,})}...}.)))..))))).,..))))))))))...))...({((...)))}.,....))))).)))}}))))))))))((((((((.((,(((((((,((((((((((((((.....(((((.(((((.((((.......(((((({..,,...((.(((({...))))).)){((.((((((({((((((((({((((({((({......((((,,|||...||||||||.....((((((((((((((((((((((({{(((({.{|||,...{{{{(,({,({.{{(.....}))},.}},))})),)))},||||||||,..{{{{|.,,,,))))),.,)))))))........))))))))...))))))).))}}})))}}}||||,|{{{{(((({((,((((....)))).,,|{{||||{..,,,{{{{{,,...(((((((((((.......)))))))))))..{((((((...((((.......)))).})))))}..|||,.||}}}}}}|}|,......................||||||||,,..{|||||,.....(((((((((((((((({(((.((((((((...((((((.((((.((((((((,((((((.....)))))).||{{{{{.((.,..(,({,{.|||{|,,,||(({{(((,(,...,,|{|}.,,,|,}}}|||||,,,.,..,})).}})))))}},,.||}}}}).}})),...})))).)))).)))))))))))))).)))|{(((((((..,.........)))))))||{{(((.(((((..((((((.....((((((((.....((((((({{,{{..(((((.....((((.((((.(((((...{((((...(((..(((.....)))..))).)))))))))))))).)))).....)))))..)})))))))))))))))))........}))))).....))))),)))},.((((({..(((.((((..((((((,,{,{(((.,{|||.||,.,{..({{{........)))),)),,,,)))))).)))).))))))))),..(((((.....}))))....)))))))))..))))))}(((.(((((........))))).)))..........}))).))))))))))))),||}.((((((((((...,,{{,..............,|{{.((((((((((((((((((((.(((....))).))))))(((((,.(({....}},}))))).{(((((((.....(((....))}{(((.{{.....},)))|((.((.((..(((((....}),)))..)).)).))...{((({,,....))))})))))))}|.(((((((((((.((.(((((((.{.{,(((((((((((((((.((((..(((((({.(((((...(((((...)))))))))}.....((((((((((((((({(((((((..,.{((((,,(({{{{(,(({..{|||||....((((,,,.}|||||||}.}}},|,|||||{{{{...,(((({.(((((||...,{,,{(((({.,(((((.........(((((((.(((((((.....((((.((((((....{({......,,{(((((((({((((.,....,}.))))..})))))).)))}}...)))))).))))..))}))))})))))))...(((((({...,,.,,,(((,,,..,,......,,}.,.,{{||}|||,,,....})))))),,,))))}.|||||..,,,,...)))))))}...))))),..})))}}}}{{,{.{{((,.(((.((((({...{{....}).))))))))))))).)),},))}|}}}}}||,...)}))....)))))}..)))))))).))))))).,.,,,........)))))))}...}))))))..))))..))))))))))))))))}.}))).)))).)).))))))))))),}.{{{{{(({,,,...))))))},.)))))))))))))),))}...}))))))))},,{,,.,,{((,({.{({....}}}.,}}},.}}})}......{(((({,(({{.........}))})))))|((((((({.,,,.{{(((.,,,(((((((((((,(((..((({..........((((((((.....)))))))).,,,.,,.,}}.(((((((((.,,.........((((((.{.......}))))))...(({{{,.,|{{||{{{{,{{.,,,,,,....,)))))..))}},,},,))))))))))))))..,....(((((.....))))}..)))),))),))).)))))....)))...))))},}|{{{.........))))))))))))......}))),.)))))))........))))))))).))}})}((((,.(((((.......)))))..)))),(((({(.((,((((({{(,,,..}}}}}}}..........,,,).}),))}})),{{|||......))))).......))))))}.,))))}}))...))))).,,,,.....})}.)).))))))))..........(((.{(..(((..((((((((.(..((((.((((..((....(((((((.(((((({((,,{,{.,|,,(({,.{(({,..{{||{.,{{(({,,,,(({,,({{{{.,,,}))}}..}||||||,||||||}}|}..,||{|||{.,,,,,}.,,,|||,..((((((,..((((((({..((((,{((,{((((((((......))))))))|{|({,((((((..,,....,,,{(({..{((({.{{(....))).))))}}))},..(((((((.,.((((((........)))))).}{(((((......)))))}.............{{.{(((.....)))).))..))))))).{{{{....))))))))))...,,}}}}},,.......}}}},..)))))))))))).)))))),})),,)))},}}}.)))))).))))))).....)).)))).))))})))).).)))..))))).)))(((((..((((((...))))))....)))))((..((((..((((,(.((((((((((((((..{{(,((....}},|||((((((((((((((...(({.....))}.)).)))))))))))}.,{,.,,,.,|....,||||{||||||((((,(,...{{{{{{{|||{{,,|,||,,.....,,,,..{{{........,,,..,,..,.,,.,(((((((((((((((...((.((((.......))))))(((((((({(.....{((({,{.,.|||,|..,...,,{{(({{{.}}||||{({((({((({,{{..,,....{(((((..((((((..{{,...((.(({..,{.....}}...))).))}}}..))))))..)))))}((((({.,|{||{||||||,,|,,,,..,.,,...,}},,,|{||||{.....{{{.,(((({((({{(((................))))))).}))))..},,,{{{....,.,,....((((((((........))))))))..,,|}}}},}},{{{.,,,,,,,....,,|}}||..|},,,,,))},)))},,,,,))))),})}))),))))))))),,.))}))))))))...(((.(((,{((,.{{{..||||.,{{((,((((({{((((....)}},,}},}}...))))},,}})}))||,,}}}.}))).))).))).)))))).)))))))))|{{.,,|,.))}......,,{.((((((((((((.(((....))).)))))))...))))).)))|.)}})))))))))),|}|{(.((.((((((((,((..,{||,(((((((((.((..(((((..(((((....}}})}..,.,,,)))))..)).))).))))))...,(((((((((.,(((((....)))))}.,})))),.})))},...)))))))).)).)}},,..(((((....)))))...,,))).))))))))))),,,.))))..))))..))..)))))))).)))))..)))..)))))))).))))))...},,.,,.....))}})),,))))).))))..........)))))))..))))....))))))))))))).)).))))}...,,,,,.,,}))))}}}))}))))}..}.))))))))))))|||{||||{(((|...}||||...(((((,..,{|||||....,,.......||||}}}.,,|{(((,...|,,|{{,,.((({{,,.,|||||{,,.{{{{{,,.,||||||{.|||||||(,....,,,,,.||||||||.|||||||((.(((((((...{{......}}.))))))).))......,|||||||.||||(((({..{{|||,..,(((((({.{|||||||...,,,,,...||||||||.||||||||...........}))))))}.)))))))|.....{{{{{{{||,,,,,.,,,||||{...((((({...||..,...}..)))))).})))),(((((((((((((,{(((.{...(((.(..(.((({((((.(,((.(({......(.((((((((.......)))))))))))).)))))))}..))).)..).)))..||,...,,,..))))))),}))))))))).))))))))).,))),,}))))))))))))))))}}}|{|||{||}}|..(((({{{((((...)))))))))),{|(,...({((({.,,,,{{....,,,||}|||}}}|({{{......))))|{{{{((((,..|||,....})))}}..}|||.}||||},((((((((.((((((...,,({(((((((....(((((..{.....((((((((..((.(((((,,(((((((.(((((((..(((((((((...))))))))).))))))))))))))))))))...))....))))))))...,....)))))....)))}})))..........)).,...)))))).))))))))}}},,,||,....((((((..(((((.(((((((((,{{,...,)}.))))))))).)))))))),,))....,,}},},{,,,,.......},||,{|||||{(((({.,,,,|}}}}},,},||||||||||||,....}}|||}}|||..,})))}})},....|||,...,,,.,},}}},....}},,(((((|....)))))){(.(((((((,,.......))))))).)),}))}})))))))..}}}},..,})||||||}}|{{((((({{,{{{{{{|......)))))}|.{{||,,,,,||{{(,({{{...,,...)))),)}})),,)))),)||,.....{{||||((,(({.,(...{{||{{|||,,.,}))))))),,,},)}}.))}}}))),}}}|||}}}}})}))..)}}}}))))))))},})}))),...))))))).))..).))).))).,,)))))...))).)))))))).....)))))))}((((((.((......)).)))))).)))))))))}},))))}))|)}},,...|{|,....}}}((((((((..........,,...))))).)))..((((.(((((((..((((.(((.((..(((.({{...........(((((.........))))).......((((....))))|.(((((.(((.......))).)))))...)))))))).)))..))))..))))))))))).......)))))).))))...,,...,...,,}.)))))...)))))))))).)))))).}},....}}.,.((({{{(,,,|||}||},|{,{|||((((((((((((((((((((((((...((((...(((((((,,.,,,,,.((((((((.(..((((.((((({,.,(((.(((((.({{....}}}.}))}}..}))},..,}}}||{|,,.,,....,},..|||}...(.(((((({....))))))).)...|||......,}|..,{{(....))})))).)).))))..).)))))))).,{((((.(({{,.}}.|||||.....,,.....{{,{((((((.{,....(((,(((...,.}}|.}}}}|))))}}|(((.{({((({((((((((((((((((((((...))))))}...}))))))}.,,|||||||,({{{.....}}}}||||}}.))).......((((((((.((((((.......)))))).}.))))))).|||||||||||,....{{{{{.{((({((((.{.(((({....})))).|.}}}}.|||,.,,.||..,.||}|},}},...|||||||{{....})}))))),......(((((......,,....,.(((((((((((((..{((.,{{{{(((((....)))))..,{{{{.....)}}}{(((((.(((((((((((((......))))))))))))).)))))}||}}..}}}..})}...............)))))))))).}}...............)))))..,{{{,............,}|}|{{{{{{{{....,|||((((|,,.......,,,......,,,.,.,.{||||||{{{{{{,,..,,.....{(.(((((((({.................}))))))))},..{{{{{{{..{((({{{...{{{{(((...,,{{,.........,||,...,.......)))))}|,||,}}}}}...{((((((,.....((((((..,,,(({.....,))}))))))....{(((((..........))))))))))))).,|}})}}}}}}}}...))))))).,,,......,)))))))))}})))))))))))))}...{{{((({,.....)})))))}}{((((((((((..((....))..))))))))))}))))),,}},.}}}},,}}),)),.)))))))...))))))))))))))))),,.....,})))))))))).|{{{{|||,,,,))))))),}...,},|((((((((((((.((.......))))))))))..))))})))))))))...}}))).....))).)))))...)))))))))))))..}}}.((((((((......))))))))(((((...........))))).((((((((,(({.((({...}))).))}))))))))....,))))))....)))).))))))).,..)))))}((((((((((((((((((((..(((((((((((.((((((((((((((((((({(((,...,}))),})))))}|{(((,,((,,,..||,,|}||,,.{((((......((((((.((.,.(((((((......)))))))..))..))))))....}}}}}|,{({{|,{{{((({....})))}.|}|,}}}},,{{,(({{{{(.((({,.{((({{{{{,..|||||...,,,,|{{{{{{{,,||,{{,||,{|||{..,,}|||},|||||.,||||||{|||}..........,{,.(((.((((........)))).))){{|{{{{{{{,||.,|)}}}}}}}}},,}},,{(((({...)))))}.|{,|||||||,}}.}|},..,(((.{{...,,,..}},.}}})}}},,}})))))))))))).}}}}}}},|,.((((((((({((((((.(..,..(((.....)))..,..).))))))).))))))))),||,....,|||||,..{{{{{.,{{.(((((((((,.(((((((((((((({.((((.......(((((....))))).........)))).)))),(({{..(((((((...)))))))..}))}..(((((((...((((((((..........((((((|,(((,{.{(((...,(((,.(((((((((((((.((.((((((((....)))))},)).}}.))}..,})))))))))).}}.)))}}.|,)))).,..}}})))))))(((....))).{,((((.(((.(((((..(((.(((((((.(((((((((((...{{((({(,,,.}}||}|,{.((((({((,(......}.))).))))),},,{|||..||||{}}}})}}|}...|||}..,....{,....,}..,,,,,,.)))))))).(((.{{,,((((........)))).)))))..{(((.,,,{(((.,,.....,)),}))),..}}},,{(((((((.{{{.,....}}}}))))))).}}..))).))))))).)))..)))))))).))))}))))))))..)))))))....,{.((((((((.(((..(((((((,,(.((((((((.{{..((((((((.{,((....,|||(((({{((((((..,.(((((.,{.{(({({((((((.....))))))..,,........((((((..(((.(((((((.{(((((.......(((((((......))))))).((.(((..((((((((..((..(((......)))..)).)))).)))).))).)).((((((((..(((((.....)))))......)))))))).,,.(((.((((((((((((((..((({(((.....,)))}})},,..)))))))))...))))).))).,,.....)))))|((((((......))))))|(,(((((((((({.((..((((((.((((((((((.{,{......}....)))))).}})}....))))))..)).,..)))))))))),)}}.....,,,|{|,,((((((.((((((((.((.(((.,(,,{..{{........}},,},.},))).)).)))))....))).))))))...,,,..))))))).)))...))))))..{(((((((........}).)))))|.||||||||,.,.,,{{||}},,.(((.....))),,..,)))))),},,..))))}....))))))))))).}}...((.(((((((((..(((((((((.(((((.......))))).)))))))))....)))))))))..)}.(((((((((((,,{.(((((((.(((((({(,....,{{{{...((((..((((((((.((,...,)).))))))))....}}}}...||}||{,||,...||||||||{||,|||||||||,..}}|}}}}}},...)))))))),))))))}.,(((....)))..(((((((...))))))){||||||.....})))}}...))).))))))))((((((.(((.,.((({{(((..,..,,,(((((.((((((...)))))).}))))((((....))))..,,..........|{{{,.{{{.....}}}}}}}},,|((((.((,.(((((((..((((((.......,(((((({{(.{(((.{((((.((((.(({{.((((...))))}}.)).)))).}}},..}}}}}).,}}}..,||,}}|||}}..|||..,,,,.,,)},(((..(((.,((.(((((....((((...(((((((((....)))))))))...))))......))))).))..)))..)))))))))..)))))))..)).)))),||({{{{|||,.......,,}})))},.}},.,..))))))).,.)))))))))..)).).))))},)))....}}.)))))))).)))))))))..)))..))))))))}}{((,...,|||.{({{{.{{|..,,))}.}})))......))))))))))).}..)))))).)))...)}.}}}}).,},..}))).))))))))).)))))))))))..))))))))))))))))))))

Transcripts

ID Sequence Length GC content
GCCCGGAUCGCCCAGCUCCGCGUUAGCCGGAGCUGCACGCGGGGCUGCC… 12651 nt 0.4422
Showing 11 to 11 of 11 entries
Summary

This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]

Forensic Context

A study in rats demonstrated that the SV2B was less abundant in spinal cord tissue until 7 days post-contusion, then showed increased expression specifically at the injury epicenter at 35 days post-injury [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042].