| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGCGCACGCGCGGCCGCUCCUGCGGGCGGAAGCCUCCUGGCGCUCGGC… | 807 nt | 0.4957 |
Enables microtubule binding activity and peptidase activator activity. Involved in axon development; proteolysis; and regulation of metallopeptidase activity. Acts upstream of or within negative regulation of endothelial cell migration; negative regulation of protein ubiquitination; and protein secretion. Located in apical part of cell. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the SVBP as a potential postmortem interval biomarker in liver tissue using MALDI-TOF mass spectrometry [Mróz et al. DOI:10.1016/j.jflm.2025.102946].