| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGAGUUGCGACGCUCGGCGGCAUAGGGGGCGGCUCCACCGACACUAC… | 5541 nt | 0.3429 |
The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
A study in human sepsis patients identified the SYCP2 as a potential diagnostic biomarker, where it was found to be differentially expressed with a consistent mRNA and corresponding protein expression pattern in the sepsis group compared to healthy controls [Wang et al. DOI:10.2147/IDR.S380137].