| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUGCGGUGGGCAGCGGAGGAGUCGUGUCGUGCCUGAGAGCGCAGCU… | 3210 nt | 0.6168 | |
| AGUCUGCGGUGGGCAGCGGAGGAGUCGUGUCGUGCCUGAGAGCGCAGCU… | 3172 nt | 0.6182 |
This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family plays a role in regulation of axonogenesis and synaptogenesis. The protein encoded serves as a substrate for several different protein kinases and phosphorylation may function in the regulation of this protein in the nerve terminal. Mutations in this gene may be associated with X-linked disorders with primary neuronal degeneration such as Rett syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that Synapsin I, a synaptic vesicle protein gene, was downregulated in spinal cord tissue samples from the injury epicenter, as well as 1 cm rostral and 1 cm caudal to the epicenter, following contusive spinal cord injury [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042].