| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACCGCCGCUGCUGUCUGCGGGGUCUGGUGCCGGGGCCUGAGUCUCUG… | 3888 nt | 0.5062 | |
| AGACCGCCGCUGCUGUCUGCGGGGUCUGGUGCCGGGGCCUGAGUCUCUG… | 3320 nt | 0.5581 |
This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family encodes a neuron-specific phosphoprotein that selectively binds to small synaptic vesicles in the presynaptic nerve terminal. Polymorphisms in this gene are associated with abnormal presynaptic function and related neuronal disorders, including autism, epilepsy, bipolar disorder and schizophrenia. Alternative splicing of this gene results in multiple transcript variants. The tissue inhibitor of metalloproteinase 4 gene is located within an intron of this gene and is transcribed in the opposite direction. [provided by RefSeq, Feb 2014]
A study in rats demonstrated that the SYN2 was downregulated in spinal cord tissue samples from the injury epicenter, as well as 1 cm rostral and 1 cm caudal to the epicenter, following contusive spinal cord injury [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042].