| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGUCGGCGCGGAGCCGCCUCGGGCCGGGCCGAGGGCUGCGCGGCGGCG… | 2709 nt | 0.6135 |
Predicted to be located in Golgi apparatus. Predicted to be active in intracellular membrane-bounded organelle and membrane. [provided by Alliance of Genome Resources, Apr 2025]
A study in mice demonstrated that binge-like ethanol consumption via a drinking-in-the-dark paradigm altered the expression of numerous genes in the prefrontal cortex, including the SYNDIG1L which was identified by RNA-seq as upregulated by ethanol, though this specific upregulation was not confirmed by subsequent qPCR validation [Vallerini et al. DOI:10.1016/J.Neuroscience.2020.09.010].