| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGGCGGCAGCGGCUGCAGCGUUGGUAGCAUCAGCAUCAGCAUCAGCGG… | 2026 nt | 0.6397 |
This gene encodes an integral membrane protein. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it is a synaptic vesicle protein that also interacts with the dopamine transporter. The gene product belongs to the synaptogyrin gene family. [provided by RefSeq, Dec 2010]
A study in mice demonstrated that chronic alcohol exposure significantly downregulated SYNGR3 mRNA expression in hippocampal tissue, as identified through high-throughput sequencing and bioinformatic network analysis [Du et al. DOI:10.3389/Fphar.2024.1377501].