Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCGCAUCCCCGGAGCAUCUUAAGAGCUGAGCGCAGCUGACAACUAGGG… | 5182 nt | 0.4620 |
Summary
This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that are known calcium sensors and mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. The encoded protein is also a substrate for ubiquitin-E3-ligase parkin. The gene has previously been referred to as synaptotagmin XII but has been renamed synaptotagmin XI to be consistent with mouse and rat official nomenclature. [provided by RefSeq, Apr 2010]
Forensic Context
A study in humans delineated age-associated mRNA expression patterns in peripheral blood and established a robust age prediction model using 34 candidate age-related genes, including the SYT11 which overlapped with genes previously reported in other studies [Liao et al. DOI:10.1016/J.Fsigen.2025.103373].