| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCCUCCGUCCCCGCCCCUCUGGCGGCGGGAGAGCUGCUGGCUCGCCC… | 5383 nt | 0.4808 | |
| CUCCCUCCGUCCCCGCCCCUCUGGCGGCGGGAGAGCUGCUGGCUCGCCC… | 5165 nt | 0.4803 |
This gene encodes a member of the large synaptotagmin protein family. Family members have an extracellular N-terminal transmembrane domain and a cytoplasmic C terminus with two tandem C2 domains (C2A and C2B). Synaptotogmin family members can form homo- and heteromeric complexes with each other. They also have different biochemical properties and developmental profiles, and patterns of tissue distribution. Synaptotagmins function as membrane traffickers in multicellular organisms. Two alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
A study in human post-mortem brain tissues demonstrated that the SYT13 is an RNA marker associated with synaptic transmission and was found to be down-regulated in chronic traumatic encephalopathy (CTE), CTE with Alzheimer's disease (CTE/AD), and Alzheimer's disease (AD) compared to normal subjects, as identified through transcriptome sequencing and differential expression analysis [Cho et al. DOI:10.1038/s41598-020-65916-y]. This down-regulation was part of a common signature of synapse signaling-associated gene alterations in these head trauma-related neurodegenerative disorders.