| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUAGAGAGAGGGAGAGACUCGAGAGCGAGCGAGCGCGGGAGCGAGGGCC… | 7614 nt | 0.5190 | |
| GCAGACUGCUAAGCUCAGCAAGUCUUGCGGCAAAGGCACUUCGGAGCCG… | 7635 nt | 0.5184 |
This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
A study in human postmortem brain tissue and iPSC-derived neurons demonstrated that the SYT2 was concordantly dysregulated in both opioid use disorder (OUD) brain tissue and morphine-treated neurons, indicating its role in opioid exposure response [Mendez et al. DOI:10.3389/Fpsyt.2023.1070556]. In a mouse model of traumatic brain injury, the SYT2 was uniquely downregulated in the striatum at 2 days post-injury, reflecting region-specific transcriptional changes following focal contusion [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. A study in rats demonstrated that the SYT2 is downregulated in the medial prefrontal cortex following a history of alcohol dependence, where its exon 1 is hypermethylated, and its functional knockdown increases tolerance to quinine-adulterated alcohol, modeling compulsive-like intake [Heilig et al. DOI:10.1111/Gbb.12344].