| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGAGCCAAAACAGGAACCGAGGUGGCAAAUCACUGUGCGAGGGCGA… | 3936 nt | 0.3788 |
Predicted to enable several functions, including calcium ion sensor activity; protein dimerization activity; and syntaxin binding activity. Involved in negative regulation of catecholamine secretion and positive regulation of dendrite extension. Predicted to be located in neuron projection terminus and secretory vesicle. Predicted to be active in several cellular components, including axon; glutamatergic synapse; and secretory vesicle. [provided by Alliance of Genome Resources, Apr 2025]
A study in humans demonstrated that the SYT4 was down-regulated in chronic traumatic encephalopathy (CTE), CTE with Alzheimer's disease (CTE/AD), and Alzheimer's disease (AD) post-mortem brain tissues, associating it with synaptic transmission [Cho et al. DOI:10.1038/s41598-020-65916-y]. In a rat model of contusive spinal cord injury, the SYT4 was found to be downregulated at 3 hours post-injury but upregulated at 24 hours within the injury epicenter [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042].