Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGUUCCUGCUGUCUGCUCAUCCGCUGACUGUGUUCACUCUUACCUGA… | 2871 nt | 0.3424 |
Summary
The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]
Forensic Context
A study in mice selectively bred for high or low methamphetamine intake identified that a major source of increased consumption in the high-risk line is a spontaneous null mutation in the trace amine-associated receptor 1 gene, which modulates dopaminergic activity [Hitzemann et al. DOI:10.3390/brainsci9070155].