| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUCUCCAGCCUGUGCCGGGCAGCUGGCACCCUCCCUACGUGUGAUGU… | 5359 nt | 0.3736 |
This gene belongs to a family of genes that function as receptors for tachykinins. Receptor affinities are specified by variations in the 5'-end of the sequence. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neurokinin 3, also referred to as neurokinin B. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the TACR3 is an orthologous gene associated with inflammatory processes in radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357].