| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGGAAGUCCCGGCGCCCGGCGAAACCACCCUCCCGUGCAGCCGAGCC… | 1877 nt | 0.6638 |
This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the BCL3 gene was upregulated in the striatum at 2 days post-traumatic brain injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528], and a separate investigation in a mouse model of myocardial ischemia-reperfusion injury identified the BCL3 as a direct transcriptional target of the lncRNA Gm18840, where its promoter activity was regulated and low Gm18840 expression upregulated the BCL3, which exerts an anti-apoptotic effect [Luo et al. DOI:10.3389/fcell.2021.615950].