Basic Information

Symbol
BCL3
RNA class
mRNA
Alias
BCL3 Transcription Coactivator D19S37 BCL4 Chronic Lymphatic Leukemia Protein B-Cell Lymphoma 3-Encoded Protein B-Cell Leukemia/Lymphoma 3 B-Cell Lymphoma 3 Protein B Cell CLL/Lymphoma 3 Proto-Oncogene BCL3 BCL-3 BCL3, Transcription Coactivator
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005178.5
Sequence length
1877.0 nt
GC content
0.6638

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-809.50 kcal/mol
Thermodynamic ensemble
Free energy: -832.86 kcal/mol
Frequency: 0.0000
Diversity: 288.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((.(((((.(((.((........))))).)).)))((((......))))...((((((((....))))))))((.(((((....((((((((((((((((((.(((((((...(((((...((((..((((((...(((((((((.....(((((((...((((((((...(((((.((((((.((((.(((.......(((((.....)))))..))))))).))))))))))).((((....)))).......)))))))).))).))))))))))))).(((((((.......)))))))...))))))..)))))))))..))))(((((((....((((..((.....))..))))...)))))))...........((((..........))))........(((((........))))).....................))))))))))).)))))).....((((.((......)))))).(((((....))))).(((((....)))))((((((.....))))))....((((((....(((((((((((.((((((.((.................(((.(.(((((((.((((.(((((.((((((.((......))..)))))))))))...))))..))).)))).).)))((((((((.((((..((...((..((.(((((((((.((..((((.((((((((((...(((((.((((((.((((..((((....))))..)))))))))).)))))...(((.((((((((....)).))))))..)))...(((((((((((.(........).)))))......))))))(((((....)))))))))))).....)))))))...)).......)))))))))))..))))...)))))))))))).........((....))..((((..(((((((((((.((...((((((.(((((.((.((...(((.....(((((.((.(((((((((.((((((.((((((((((.....))))).))).)).))))))))..)))).)))((((....)))).....)).)))))......))).)))).))))).))))))...)).)).(((((...........(((((((((((((....)))))..)))).)))).......)))))((((.......)))).........(((....)))))))))))))))))))))))).(((((..............)))))((((((((...(((.(((((.(((((((((....))))))........(((......)))...............((((((((((..(.(((((((((......(((((((......(.(((.((((....)))).))))....)))))))..)))))))..)).)..))))))))))))).))).)).)))....)))))))))))))))))))....((((((((....((((((...(((((.(((((.....(((..(((.............)))..)))))))).)))))..((....))........................((((..(((((......))))).))))....))))))...))))))))(((((((((((........))))...)))))))........................((((((((((..((((((((....((((........))))........))))))))....))).)))))))))))))))))......))))).))((((.(((((..........))))).)))).)))))))))))........................
Thermodynamic Ensemble Prediction
{((((((((((.(((((.(((.((........))))).)).)))((((......))))...((((((((....)))))))){{.(({{({{.((({,((((((((((((((,(({(((({{{((((....((((..((((((...(((((((((..,,.((({((({{{(({{{{{{...(((((.((((((.((((,(({.......(((((.....)))))..))))))).))))))))))).((((....)))).....},))))))})})}),}}}}))))))))).(((((((.......)))))))...))))))..))))....,..,.,,(((({{{....{{{{..|{.....}}..)))),,}))))))).,},.......((((..........}})}........{{{((..,..,..)}}||.......,...,,.,..,,..})))))))))).)))))).,{,.((((.{(,,,...}}}}))}||,,...,,|||||.(((((....))))|((((((.....))))))|,,.,{{{{,....(((((((((((.((((((.({.................(((.(.(((((((.((((.(((((.((((((.((......))..)))))))))))...))))..))).)))).}.)))((((((((.((((..((...((..((.(((((((((.((,.((((,(({(((((((...(((((.((((((.((((..((((....))))..)))))))))).)))))...,((.((((((((....)).))))))..)),...(((((((((((.(........).)))))......))))))(((((....)))))))))))),,...})))))),}.}}.......))))))))))).,)}))...)))))))))))).........((....}}..|{|({.(((((((((((.((...((((((.(((((.((.((...(((.....(((((.((.(((((((,{,((((((.((((((((((.....))))).))).)).)))))))}..)))).)))((((....)))).....)).)))))......))).)))).))))).))))))...)).)).(((((...{.......(((((((((((((....)))))..}))).))))...,...)))))((((.......)))).........(((....)))))))))))),))})))))))).(((((..,......,.,..)))))((((((((...(((.((((({(((((((((....))))))........{((......))}...............((((((((((..(.(((((((((......(((((((......(.(((.((((....)))).))),....)))))))..)))))))..)).)..))))))))))))).))).)).)))....)))))))))))))))))))....((((((((....((((((...(((((.{((((.....(((..(((.............)))..)))))))}.)))))..((....))........................((((..(((((......))))).))))....))))))...))))))))(((((((((((........))))...)))))))...,,,|,.....,,,..,..,.{((((((((((..((((((((...{((({........},)),}......))))))))....))).))))))))))))))))}}},..,))))),))((((.(((((..........))))).)))).))))))))))},,..,{{,.....,},,},,....

Transcripts

ID Sequence Length GC content
AGGGGAAGUCCCGGCGCCCGGCGAAACCACCCUCCCGUGCAGCCGAGCC… 1877 nt 0.6638
Summary

This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the BCL3 gene was upregulated in the striatum at 2 days post-traumatic brain injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528], and a separate investigation in a mouse model of myocardial ischemia-reperfusion injury identified the BCL3 as a direct transcriptional target of the lncRNA Gm18840, where its promoter activity was regulated and low Gm18840 expression upregulated the BCL3, which exerts an anti-apoptotic effect [Luo et al. DOI:10.3389/fcell.2021.615950].