| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUCCUCUGUCUCCGCGGAUGACGAGUGGCUGGAUAACAUGGAGUCGG… | 2657 nt | 0.3658 |
Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is similar to one of the small subunits of TFIID, TBP-associated factor 9, and is also a subunit of TFIID. TAF9 and TAF9b share some functions but also have distinct roles in the transcriptional regulatory process. [provided by RefSeq, Jul 2008]
A study in mouse primary cortical astrocytes demonstrated that brief ethanol exposure significantly activated the TAF9B alongside numerous other alcohol-responsive genes, with this activation mediated by the heat shock factor 1 (HSF1) pathway via a specific alcohol response element [Pignataro et al. DOI:10.1002/Brb3.125].