Basic Information

Symbol
TAF9B
RNA class
mRNA
Alias
TATA-Box Binding Protein Associated Factor 9b DN-7 TAFII31L TFIID-31 TAF9L DN7 TAF9-Like RNA Polymerase II, TATA Box Binding Protein (TBP)-Associated Factor, 31kDa TAF9B RNA Polymerase II, TATA Box Binding Protein (TBP)-Associated Factor, 31kDa Transcription Initiation Factor TFIID Subunit 9B Transcription-Associated Factor TAFII31L Neuronal Cell Death-Related Protein 7 Transcription Initiation Factor TFIID Subunit 9-Like Transcription Initiation Factor IID, 31kD Subunit TBP-Associated Factor 9L
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_015975.5
Sequence length
2657.0 nt
GC content
0.3658

Transcripts

ID Sequence Length GC content
CUCUCCUCUGUCUCCGCGGAUGACGAGUGGCUGGAUAACAUGGAGUCGG… 2657 nt 0.3658
Summary

Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is similar to one of the small subunits of TFIID, TBP-associated factor 9, and is also a subunit of TFIID. TAF9 and TAF9b share some functions but also have distinct roles in the transcriptional regulatory process. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mouse primary cortical astrocytes demonstrated that brief ethanol exposure significantly activated the TAF9B alongside numerous other alcohol-responsive genes, with this activation mediated by the heat shock factor 1 (HSF1) pathway via a specific alcohol response element [Pignataro et al. DOI:10.1002/Brb3.125].