| ID | Sequence | Length | GC content |
|---|---|---|---|
| CGAGGAGCGAGCCAGUGGGGGAGGCUGACAUCACCACGGCGGCAGCCCU… | 4260 nt | 0.5671 | |
| AUCCUGUCUGUCCGAACCCAGACACAAGUCUUCACUCCUUCCUGCGAGC… | 3786 nt | 0.5589 |
This gene encodes a shape change and transformation sensitive actin-binding protein which belongs to the calponin family. It is ubiquitously expressed in vascular and visceral smooth muscle, and is an early marker of smooth muscle differentiation. The encoded protein is thought to be involved in calcium-independent smooth muscle contraction. It acts as a tumor suppressor, and the loss of its expression is an early event in cell transformation and the development of some tumors, coinciding with cellular plasticity. The encoded protein has a domain architecture consisting of an N-terminal calponin homology (CH) domain and a C-terminal calponin-like (CLIK) domain. Mice with a knockout of the orthologous gene are viable and fertile but their vascular smooth muscle cells exhibit alterations in the distribution of the actin filament and changes in cytoskeletal organization. [provided by RefSeq, Aug 2017]
A study in humans identified TAGLN as a marker for vascular smooth muscle cells in carotid atherosclerosis and as a smooth muscle cell marker in erectile dysfunction, where its expression was down-regulated along a pseudotime trajectory from smooth muscle cells to fibroblasts [Xue et al. DOI:10.3233/JAD-230559][Fang et al. DOI:10.3389/fendo.2022.874915].