Basic Information

Symbol
TALDO1
RNA class
mRNA
Alias
Transaldolase 1 Transaldolase EC 2.2.1.2 TALDOR TAL Testicular Secretory Protein Li 56 Dihydroxyacetone Transferase Glycerone Transferase TAL-H TALDO TALH
Location (GRCh38)
Forensic tag(s)
Individual identification Other applications

MANE select

Transcript ID
NM_006755.2
Sequence length
1199.0 nt
GC content
0.5363

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-408.10 kcal/mol
Thermodynamic ensemble
Free energy: -429.35 kcal/mol
Frequency: 0.0000
Diversity: 253.31
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((....)))))((((.((.....(((.((((((..(((...(((((.((.(((((((.((((...((((..(..(.((((((...)))))).)..)..))))....)))))))....((((.......((((((((..(((((((.(.((((((((....(((.(((((.((..(((.((((..((((((((...))))).)))..)))).))).)).))))))))....))))))))(((((((((.....(((((........)))))...)))))))))..(((((((((...............).))))))))...(((((....((((.(((.((...))))).))))......)))))).))))))).....(((((.((((((((.((((((....)).)))).)((.(((((((((.....))))).....)))))).....(((....)))....(((.((((.((((((...(((..((..((..(((.....)))....))..))..)))..))))))...)))).)))..(((((((((((...(((((((.(((.((..........))..))))))))))....)))))))).)))....................)))))))))))).....))))))))......))))........(((.((((.((...)).)))))))..((((.....))))...)))).))))))).)))..)))))).)))..)).))))(((((((((.((((.....))))...(((.((((......)))).)))..((.(((((....(((((...))))))))))))(((((.(((.((.((......((((....)))).......)).))))).))))).(((((..(((((......))))))))))((((.((((.......)))).)))).(((.((((((.(((((..(((((...))))))))))...)))))).)))...((((....))))..((((((...((((...((((.((....))..))))...))))..))))))..)))))))))..((((..(((((((((((((.(((....))).).))))).........(((((.((((((......((((((........)))))).....)))))))))))........)))))))..)))).
Thermodynamic Ensemble Prediction
(((((....)))))((((.((.....(((.((((((..(((...(((((.((.((((,.{,(({,.,,||{{{{{{{{.........((((((((...{..((((.,,{{,..{{....,}.,)}},....))))..}...))))))))..((((({((,.,.{,({(((((.((,,{{{.((((..((((((((...)))))}}))..)))).})),}).))))))),..,.))))))))(((((((((.....(((((........)))))...))))))))),}}|}}|||}}.......,,......,.,,,,(((((..((.((.((....)).)).))..))))),.||||....,,}{{(((((((((((((.((((.((((((((.(((((((((....,...((((....}}}}.,{({,,,,,|||||.....|,||,,..||.{{{{{,.,,,,,}))})),),....))))))))).)))).{{{.{{,..,,.,)))..,..,..},,...,........))))..)))).))))).{((((((...(((((((.(((.{{..........}}..))))))))))....)))))))(((({{,{{...,,,,.,.....,,.,..(((((.((.....)).)))))..,.|||}},........,,...,||.,,...}}.,)))).)))))...))))))),)}))))).))))))).)))..)))))).)))..)).))))(((((((((.((({..,,,||||{{.(({.((({......}))).))),}{{.(((((....(((((...})))))))))))(((((.((,,((.((......((((....)))).......)).))))).))))).(((({..(((((......)))))})))){|||,||{|,.,,,,.)))).}}||.(((.((((((.(((((,,{(({{..,)}))))))))...)))))).))).,,((((....))))..{(((((...((((...((((.(,....,}..))))...))))..))))))..)))))))))..((((..(((((((((((((.(((....))).)},)))).........(((((.((((((......((((((........)))))).....)))))))))))........)))))))..,)))}

Transcripts

ID Sequence Length GC content
AGACCCCUCGGUCUUGCUAUGUCGAGCUCACCCGUGAAGCGUCAGAGGA… 1199 nt 0.5363
Summary

Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the TALDO1 gene, identified as a housekeeping gene involved in metabolic processes, exhibited differential expression between monozygotic twins, belonging to the least variable category of natural variation in blood leukocytes [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In a separate human study, the TALDO1 was identified as an obesity candidate gene, where its expression in abdominal subcutaneous adipose tissue increased significantly in lean subjects after a 7-day overfeeding intervention but decreased slightly in obese subjects, showing a significant interaction effect between adiposity status and overfeeding treatment [Shea et al. DOI:10.3945/ajcn.2008.25970].