Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACCCCUCGGUCUUGCUAUGUCGAGCUCACCCGUGAAGCGUCAGAGGA… | 1199 nt | 0.5363 |
Summary
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis. [provided by RefSeq, Jul 2008]
Forensic Context
A study in humans demonstrated that the TALDO1 gene, identified as a housekeeping gene involved in metabolic processes, exhibited differential expression between monozygotic twins, belonging to the least variable category of natural variation in blood leukocytes [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In a separate human study, the TALDO1 was identified as an obesity candidate gene, where its expression in abdominal subcutaneous adipose tissue increased significantly in lean subjects after a 7-day overfeeding intervention but decreased slightly in obese subjects, showing a significant interaction effect between adiposity status and overfeeding treatment [Shea et al. DOI:10.3945/ajcn.2008.25970].