Basic Information

Symbol
TARDBP
RNA class
mRNA
Alias
TAR DNA Binding Protein TDP-43 ALS10 TAR DNA-Binding Protein 43 TAR DNA-Binding Protein-43 TDP43
Location (GRCh38)
Forensic tag(s)
Sudden death from CNS diseases

MANE select

Transcript ID
NM_007375.4
Sequence length
4185.0 nt
GC content
0.4045

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1205.70 kcal/mol
Thermodynamic ensemble
Free energy: -1288.10 kcal/mol
Frequency: 0.0000
Diversity: 1029.17
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((...((((((((((((.(((((.......)))))))))))))))))((((((((((..(((.(((((..((((((((((((....((((....(((((.........(((((....)))))........(((((....))))).....((((((.....))))))...((.((((((((.(((..((((..(((((((..(((((((((((((((((((((((.(((..((....(((((.....)))))))..))).).)))).))))....))))))))))))...))..))))))).....((((((....(((((...((((((...................)))))).)))))......))))))..))))..)))...)))))))))).....)))))..)))).....)))))))))..((((((((.....((((..(((..((((((.....))))))..))))))).....))).)))))...(((((......))))).....(((.(..((((((((..((((((((((((.(..(((.(((............(((....(((..((((((.((...(((.....))).....)).)))))))))..)))))))))..)..)))))))))))).....)))))))).).)))......)))..))))).)))..)))).)))))).((((((((.(((((.....))))).)).))))))..(((((((.(((....)))..)))))))..((((((..(((...(((((..((((((..((((.((((((((........((((.((((....))))))))))))))))..(((..((.(((((.........))))).)).)))..((......))(((((...((.((...((((((.((((((((((((((...((((.(..(((((((((((..((((((((((.....((((((((((.((((((((.....((((((((...(((.((..(((((((...(((((((.(((((((((.....)))))......((..((..(((((((.....)))))).)..))..))((((.((((((.(.((.((((((((((((((..(((((((((((.(((((((.((((.....((..((((((.((..(((.((((((((((((..(((((((...)).)))))...............)))))))..))))))))..))..))))))..))......)))).))...))))).)))..))))))...))..)))..)))))..)))))).......((((....))))(((((((...(((((.(((((.(.((..((..((((((..((((((((..((((((((.....((((....(((((((((((((((...)))).)))))))..((((..(((....)))...))))((((((.(((((.((((((........(((((..(((((((((............)))))))))............)))))........))))))))))).(((((((.......)))))))(((((((.....)))))))...)))))).........(((((..(((((((...((((....))))...(((((.(((.(((......))).))).)))))....))))))).))))).((((.....)))).))))....)))).)))))))).))))))))..(((......)))........(((((((...)))))))...(((((((..((((.(((...........((((....))))...........))).))))....(((((.(((...((..(((((...((((((((.(((.(((((((...(((((((((......((((((...........)))))))))))))))..((((((((((((((((((.((((((((((......)))).(((.((((((.(((((....(((((((...)))((((((((.........))))))))(((((.........)))))(((((((..(((.((....)).)))..)))))))....((((((..........)))))).........))))...))))))))))).)))))))))..)))).)))))............((((((.(((((((.(((........((.((...)).)).........))).))...)))))))))))..)))))))))...))))))))))..))))))))..)))))..))..))).)))))((((((.....))))))...((....))..(((((...((((((((......)))))))).....)))))....((((((.....))))))..........)))))))))))))))))).))))).)))))(((((((((((((..((((((((....((((.(...((((((............))))))..).))))....)))...((((((((((((.(((((((((((.(((((.(((((((((.....))....))))))).)))))..)))))))..............((((((.....(((((....)))))))))))...(((..(((((.....))))))))((((((.......))))))......((((((((.(((....))).))))))))......((..(((.....)))..)))))).)))))).))))))...)))))....))))))))))))).)))))))...((((((....(((((((..((((((((..((((((.((((.(((((......)))))))))..))))))...)).))))))))))))))))))).((........))(((((.....)))))))).)))))).))))..(((((((..((((((((((.....(((((.(((((.......)))))))))).(((((((((..(((.(((((.(((((.(.(((((......)))..)).))))))...))))).)))((((.((((((..((((..((((.((((.......)))).))))))))(((((((.(((((((((...(((((.((....((((....)))).....)).)))))...(((((((.(((((((.((((((((...)))))))).((....))..)))))))))))))).)))))))))..)))))))....((((((.((....(((...(((((((.((.(......).))...))))))).)))...)).)))))).))))))))))..(((((.(((..((((........))))))).)))))......((((..((((...))))))))..(((((((((.((..(((((...(.((((((.....((((((((((........((((.(((((((((.......((((..((((.(((((..((((((.........)))))).))))).))))..))))..)))))))))))))....((((((....))))))..))))).))))))))))).)....)))))..)).))))))))))))))))))((((((((....))))))))..)))))).......))))..))))))))))))))))))....))))))))).)))..)))))))).....)))))))))))).(((((.(((.....))).))))).........))))))..)))))))))).))))))))))))))))))))))).))))))).))))))....)).)).))))).....))))..)))))).)))))..)))..))))))....(((....)))...(((((((((((........(((((((...((((((.....((((((((...)))).))))..)))))).)))....))))........))))))..)))))((((((((((((((....)))).)))))))))).....((((((((......)))))))).(((((.......))))).((((((((((((.(((((((......)))))))((((((((((((....((((((..(((.(((((((.....))))))).))).....))))))..))))))..))))))...))))))))))))......)))))
Thermodynamic Ensemble Prediction
....{((((.,.((((((((((((.(((((.......))))))))))))))))){{((((((((.,(((.(((((..{(,(((((((((.....,,{....((((({{...,,,.(((((....))))).,},,,..(((((....))))).....((((((.....))))))...((.((((((((.(((..((((,{((((((,{{,.(((((((((((((((((((({.(((..((....(((((.....)))))))..))).,.)))).))))....)))))))))))).}}.)}})))))}}.....{((({(,,{.(((((...((((((...................)))))).))))},,},..))))})..))))..)))...)))))))))).....,))))..|}},.....))))))))).,({{{||{{.....||{{..|((..((((((.....))))))..))}}}||,,...})}||}|||,{{(((((..{{..||||}.....|||}|}.|{{{{{((,,((((((((((((.(,.(({.{{{,..,,..,,....||,...{{..,((({{{.{|,|}|,{,,,,.|||,,,,.||,|}}}}||||,.||}}}}},,..|..,}}}}}))}})).....)))))))},|,||}.....,)))},))))),))),,||||,||}}}},((((((((.(((((.....))))).)).))))))..(((((((.(((....)))..)))))))..((({{{..{||,..{{{||,,||{{{{..{({{.((((((((,.......{((({(((,...}))))))))))))))))..{{{..{{.{||||,,....,..))})),)),)))..((......)),,,,,...{{,{,...((((((.((((((((((((((...((((.(..(((((((((((..((((((((((.....((((({((((.((((((((.....((((((((...(((.({..(((((((...(((((({,({(((((((.....)))))},..((((({...}))))),((((((.((((((.{.((.(((((((((((((.{..(((((((({((((((((..(((((((((((.(((((.,.{(({.....((..((((((.((..(((.((((((((((((..(((((((...)),}))))...............)))))))..))))))))..))..))))))..}|,,..,,|}}}.}}},.))))).)))..))))))...))..))),.,))))..})))))...,,.,(((({{{{||||(((({{{..{((((({(((((({,((({((,,((({.{{{(({{((({....,..,,..||||{,.,{{{{{{{.(((((((((((...)))).)))))))..{{{{,{{{{,.{{({{.,,{{|||{{((,||{.{{{{,,{{{|||||{|||{||}||(((((((,,..,}}}}}}}},}}}}}}}}|||||..||}||||{{{{{{.||||,.||||,||{|{{{{{{||||,,|||..,}}))){((((((.....))))))))))).)))),))}}..,.,||||..{{||||,..}||||},..,},|,,.(((((.(((.(((......))).))).)))))....))),)))}}}))}}||||},,}}}))}.}))),,.,}}}),})))..}}))))))|,,..(((......)))..,.,...(((((((...)))))))...({{{{{,,{(((({,{{...........,{,,....))))},,},,.,,,,,,,.,,,}....(((((.(((...((..(((((...((((((((.{((.((((((,..,(((((((((......((((((.{.......}.))))))))))))))}..((((((((({((((((((.(((((({(((....,,,}},,(((.((((((.(((((.,..(((((((...)))((((((((.........)))))))){((((.........))))|(((((((.,(((.((....)).))).,))))))),...(({({{,,..,,.,..}}}}})...,,....))))...))))))))))).)))))))))..}))}.)))))..,.........((((({{((({({(.{{(....,,.,{{.{,...,}.}}.........))}.))}.,}))))))))))..)))))))))...))))))))))..))))))))..)))))..))..))).)))))((((((.....)))))).,|||}}}}}},.,,,,|}}}}|||||||..,..,|}|}}}|}...}})}},,....((((((.....)))))).{{{(({......)))))}..,.}))},)))))).....,))))))).)),.)))))).))).))).|,,,.,...,,{{{,{{{{{{{{..(((((((..{{{(({|{,.,{(,,,,((((((((((((,{{{((((((((,(((((.((((((({{,....}),...))))))).))))).,)))))))),,,|||,......((((((.....(((((....)))))))))))...{((,,((|{{.....)))))))}((((((.......)))))).,{{{,((((((((.(((....))).))))))))..}))}|,..{{{.....,,|.,|,|}}|,|}|}}}.|}}}}},|,||}},,,}.})}))},((((((((((((.((((((((((....(((((((..((((((((..((((((.((((.(((((......)))))))))..))))))...)))))})))))))))))))){(((((..(((((((((..((((((.((,....,.{(((((((((((.{((((...(((....)))...))))},,.(((((.....,})))}),|{{{((({...}))))})})))))))))))}{{.(((((......)))..)).}}.......{|{,,......}}.)}}}).)))))).})))))))).)))))}{((((....,))))|(((({(,(((((((((.,.({((({((,,,,((,,.,,,.))),}}))}),))}},...(((((({,(((((((.((((((((...)))))))).,{....},..)))))))))))))).)))))))))..)))))),)))))).))))))))))))....((((((({((,.......,{{{,...,,},}}}}}|||,...{(({,,.{{{|{({{{,,,{((({{,...,}}}}}}))))}.))},,}}}}}.,.....,}|||,..,,)))}})))))}}}..(((((((((.{(..(((((,.,(.((((((,..{((((..{((((........((((.(((((((((..,.,,.{{{,..{{{,.(((((..((((((..,......)))))).)))))..})},,,}}}..)))))))))))))....((((((....))))))..)))))})))}))))))).}..},)))))..)}.)))))))))..,,.,,..{(((((({....}))))))},,}}}}.)))))))..)))},})))).,}))))))))))....)))))))}}.)))..))))))))...,.))))))))))))..{((({((..{{(({....))))}..}}}}}})))))).,)))))))))).)))))))))))))))))))))}),))))))).)))))).,,,}},)),)))},.....}}}}.,))))}}.}}}}}..}}}..}))))).},.||||,,,})).,.(((((((((((....,,,.{{{{|.,...((((({.....((((((({...}))).))))..))))))..,|,,{.}}}}.,,,,...))))))..)))))(((((((((({(((....)))}.)))))))))).....((((((((......)))))))).(((((.......))))).{(((((((((({.{((((((......))))))|{((((({{(((({({.,,,....,|||.(((((((.....))))))}.,},......,},}}},))})))..)))))),..})))))))))))......))))}

Transcripts

ID Sequence Length GC content
AUUUUGUGGGAGCGAAGCGGUGGCUGGGCUGCGCUUGGGUCCGUCGCUG… 4185 nt 0.4045
Summary

HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene is a transcriptional repressor that binds to chromosomally integrated TAR DNA and represses HIV-1 transcription. In addition, this protein regulates alternate splicing of the CFTR gene. A similar pseudogene is present on chromosome 20. [provided by RefSeq, Jul 2008]

Forensic Context

A study in a human patient demonstrated that phosphorylated TDP-43 (p-TDP-43)-positive inclusions, a diagnostic hallmark of ALS, were detected via immunohistochemistry in residual neurons of the spinal cord, hypoglossal nucleus, cerebellar dentate nucleus, and parahippocampal gyrus during an autopsy of a case with dropped head syndrome [Tanikawa et al. DOI:10.1111/neup.12583].