| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUUGUGGGAGCGAAGCGGUGGCUGGGCUGCGCUUGGGUCCGUCGCUG… | 4185 nt | 0.4045 |
HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene is a transcriptional repressor that binds to chromosomally integrated TAR DNA and represses HIV-1 transcription. In addition, this protein regulates alternate splicing of the CFTR gene. A similar pseudogene is present on chromosome 20. [provided by RefSeq, Jul 2008]
A study in a human patient demonstrated that phosphorylated TDP-43 (p-TDP-43)-positive inclusions, a diagnostic hallmark of ALS, were detected via immunohistochemistry in residual neurons of the spinal cord, hypoglossal nucleus, cerebellar dentate nucleus, and parahippocampal gyrus during an autopsy of a case with dropped head syndrome [Tanikawa et al. DOI:10.1111/neup.12583].