| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUGCCCCUGUAACCUGUCAAAGAAGAGCUAAGGGAGCUUUCGGGGUUG… | 3945 nt | 0.4416 |
This nuclear gene encodes a mitochondrial protein tyrosine aminotransferase which is present in the liver and catalyzes the conversion of L-tyrosine into p-hydroxyphenylpyruvate. Mutations in this gene cause tyrosinemia (type II, Richner-Hanhart syndrome), a disorder accompanied by major skin and corneal lesions, with possible cognitive disability. A regulator gene for tyrosine aminotransferase is X-linked. [provided by RefSeq, Jul 2008]
A study in *Lophophora williamsii* demonstrated that the expression of the TAT (specifically unigene NFSLW_ISO0055341, annotated as tyrosine aminotransferase/nicotianamine aminotransferase) was more highly expressed in specimens without mescaline, while another unigene (NFSLW_ISO0024105, annotated as probable aminotransferase TAT2/tyrosine aminotransferase) showed higher expression in specimens containing mescaline, with both associated with isoquinoline alkaloid biosynthesis pathways [Hwang et al. DOI:10.1111/1556-4029.15679].