| ID | Sequence | Length | GC content |
|---|---|---|---|
| UGACUGCAUCACCUGGUCUGUGAAUUUUCCAUUAGAAGCUUGGUGUGCU… | 7869 nt | 0.4445 |
Enables AP-2 adaptor complex binding activity and retromer complex binding activity. Involved in several processes, including macroautophagy; positive regulation of receptor internalization; and retrograde transport, endosome to Golgi. Located in several cellular components, including Atg1/ULK1 kinase complex; autophagosome; and cytoplasmic vesicle membrane. Part of retromer complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in Wistar-albino rats demonstrated that the TBC1D5 gene, identified as part of the response to brain injury, was down-regulated at 12 hours post-mild traumatic brain injury and subsequently up-regulated at 48 hours [Colak et al. DOI:10.1016/j.injury.2012.01.021].