| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAAGUGUCCUGAGUCUCGAGGAGGCCGCGGGAGCCCGCCGGCGGUGGC… | 3022 nt | 0.3703 |
The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. The protein is also an important kinase for antiviral innate immunity response. [provided by RefSeq, Sep 2021] CIViC Summary for TBK1 Gene
No relevant information is available at the moment.