Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUGCUGGUUGAAGUGCUUUCUGUCUAGUGAGGGGGUCUGUGGAUUUC… | 3806 nt | 0.5189 |
Summary
This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
Forensic Context
A study in rats demonstrated that acute ethanol exposure increased mRNA levels of TBR1 in the amygdala, which was validated by qPCR and associated with an overall permissive chromatin state underlying anxiolysis [Krishnan et al. DOI:10.1038/S41380-022-01732-2].