| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCGCUCUCCUGCCUGGAAGUGCUGACAGAUCAAGGCAACAAAUUUCAA… | 6430 nt | 0.4149 |
This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
A study in mice demonstrated that the TBX18 transcript is a marker for epicardial-derived epithelial cells, mapping to a specific cluster identified through single-cell RNA sequencing in a model of arrhythmogenic cardiomyopathy [Yuan et al. DOI:10.1161/CIRCULATIONAHA.120.052928]. In a rat skeletal muscle contusion model, the TBX18 mRNA was one of 13 genes selected in a stepwise Fisher discriminant analysis model to classify wound age into three temporal groups (control, 4–24 h, and 28–48 h post-injury), contributing to a multivariate statistical framework for wound age estimation [Du et al. DOI:10.1007/s00414-018-01990-2].