Basic Information

Symbol
TBX18
RNA class
mRNA
Alias
T-Box Transcription Factor 18 T-Box Transcription Factor TBX18 T-Box Protein 18 T-Box 18 CAKUT2 PUJO
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Wound age identification

MANE select

Transcript ID
NM_001080508.3
Sequence length
6430.0 nt
GC content
0.4149

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1852.90 kcal/mol
Thermodynamic ensemble
Free energy: -1981.97 kcal/mol
Frequency: 0.0000
Diversity: 1751.41
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((..(((((.((..((....))..)).)))))(((((((...............)))))))......))))))((((((((((((.(((((((((((((.(.((.....)).).)))..(((((.((((..(((.(((((((((((((.(((..(((((((((((.((.....))..))))((((((.....(((((((((....))).(((((((...))))))))))))).((((..(((..(((((((((((((.........))))))))))...))).)))))))(((((((...(((((((....)))))))))))))).....(((((.((((((((((((((.((((((......))))))(((((((.......((((((.((((((.(((..((((((((((((((.((...((...((((((.((((...(((.(((...(((....)))))).)))....))))(((((.((((.((((((((.((.....((....(((((....))))).)).....)).))))))))((((((((((((((((..((((((((...(((.((((((((((((.(((((((((.....(..(((((...)))))..)....)).))))))).)))))).)))))).)))..))))((((((...(((((.(((.((((....((((((.((((((..((((((..((((((.((((((((.((((((((((((((....((.....))))))))))))(((..(((((((.(((((.((((((.(((...))).)))).......))...))))).)))))))..))).....)))).))))))))..((((((((....))))).)))...(((.((..(.(((...))))..)))))(((((((((..((((((((...((...((((.(((((.......))))).))))...))......(((((((.((......((.((((.(((.....((((.....((((....))))..((((((.....((((((.((.((.((((((((.(((((((((((((...))).))))).((((((((.(((.((((...)))).)))..))))))))....((((.(((((((....)))))))))))..............((((((....((((...................(((((...............))))).(((.........)))((.(((((.......)))))))....))))....))))))(((((((((..........))))))))).....(((((((((.....((..((((............))))...)).....))))))))).(((.((.....)).)))(((((((((.((((.(((..(......)..)))))))))))))))))))))..)))...))))))).)).))))))....)))))).....)))).......))))))).)).......)).)))))))...........((((((...)))))).)))))))).)))..))))))......))))))...))))))))))))...))))))....))))...))))))))))))))((((.((....)))))).))))))))))))))).))..)))(((((........)))))......(((..((((............))))..))).........((((((((((.......))))))).)))((((.((((((((((.....)))....)))))).).)))))))).)))))........(((..((((((((..(((.((.....)).)))))))))))..)))..((........)).......((((...))))...)))))).))...))..)))))).)))))).))..))).))))))........(((((....))))).(((.........)))........)))))))))))))..((((((((...(((((....(((((.....((((((((.((((.((((((....)))))).(((((((...)))))))(((((.(((...)))))))).....)))).)))))..(((((((((..((.(((.((.....)).)))..))..))))).))))(((((((((((...(((((....))))).(((((((.....((((((..(((.((........)).)))..)))))).....)))))))....((((........))))...(((((...(((((........)))))..))))).)))))))))))..(((((((((...(((((...(((((((((((((((((...((((((...((((.((((((.(((((((((.(((.((..((((((((...((((((((.....)))))))))).))))))..)).)))(((.((..(((.(((......((((((((.((.....))))))).)))((((((((((((....(((((..(((((((((.............((((.(((((((..((((.(((..(((((((.(((((((.((((...............((((.((....((((((...((((((((((.....))).))).)))).((........))...)))))).)).))))...)))).))).))))...))))))).................))))))).)))).))).))))))).))))))..)))))....((((((((.....))))))))....................))))))))))))....(((((.(((.........)))))))).........(((((((((...))))))))).((((((...(((((.........)))))))))))...))).)))..)).)))))))).))))..))))))..))))..)))))).))))).)))))))).))))....)))))...)))))))))..(((((((((.....)))))))))...............))))))))(((((..((((..((((((((...................)))).))))...))))..)))))...))))))))))))).........(((.(((...))).)))..((((((((...........))))))))((((((.......)))))).........)))))))))....))))).)))))..(((.(((((((........(((....)))))))))).))).))))))...)))).....)))..)))....))))))))..))))).)))..)))))))))...((((((((((((((.(((((((..(((.(((.(((((....))))).))))))........))))........))).))))))..)))))))).(((((((....(((....)))...)))))))((((...)))))))))))))).)...........(((((((((..((((((((((....((((((..((..(((..((((......)))).)))..))..))))))((((.(((((.(((((((((((((((((((.(((..(((((...((.(((((((.....(((((((((...((((....((((((.((((.......(((((((.(((((((....((((((((.(.((((....)))).).)))..........)))))..(((.....))).......))))))))))).)))...........))))..))))))))))....)))))))))))))))).((((((.......)))))).((((......))))((((((.(((((((...))))))).)).)))).....((((((.(((...((((((((((((((..((...(((((.(((((.((((.......((((((..(((((((.((((((((((((((((((.(((..(((((.(((((((....))))))).)))))..)))..))))..........)))..)))).)))))))....((((.((((.....(((.......)))...)))).)))))))))))..))))))))))))))))))))..)).....(((((((((((((...((..((((((.(((((((((((.((.....)).)))))))).((((((((((((......)))).....))))))))................((((((...))))))..(((((((((.(((((((((..(((...((((((((((..(((((((((.(((((..((((...((.(((((((((((((.((((((..........((((((((((((((((......(((((((.((.(((........((((((((((..((((((...........(((((((.....))))))).........))))))..)))))......(((((((.........)))))))..........)))))..........(((((((((.((((.....((((((.(((((((........((((...(((((((.......(((((............)))))(((((..(((((((((((.(((((....((..((.((.((.(((...........))).)).)))).))...))))).)))))))))))...))))).)))))))...))))))))))))))))))))))))))))))))).)).))))))).(((((((........)))))))......))))..))))))).........((((..(((((((.........((((((((((((.((..((((((((((((((((..((....)).))))..))))..................(((((((((..((((((((((...))))....)))))).....))).)))))))))).)))))).)))).......)))))))))))))))..))))....)))))(((((...........))))))))))).))))))...))))))).)).............))))...))).)))))))))))))))))))))..............(((((.((((((..........(((((((.((...(((....(((..(((((((....))))))............)..)))..)))...))))))))).....(((((((((((...(((((((((((.((((((..((((((((....((((((((..(((.((.....(.....).....)))))..))).....)))))..))))).))))))))).))))))).))))..................((((((.(((((...))))).))))))(((((.......))))).(((((((((((((....))))(((..(......)..)))..((((((...)))))))))))))))))))))).)))).........)))).)).)))))(((((((.....)))))))................)))..)))))).)))))))))))).......))).))))))....(((((....)))))((((((......((((........)))).....)))))).....(((....)))..((((.(((((((.((((.((....)))))).........)))))).).))))))...))))).))))))))......))))))))).)))))...)))))))))..))..)))))..)))))))))......((((...(((((.((((...........)))).)))))..))))......))))))))))))).)))))))))...))))).)))))..))))))))).)))))))))))...............((((((..((...((((((.....((((((((((((((((...........(((((((((((((((.....(((((((...))))))).((((((......)))))).)))))))(((((....)))))..(((((((...((((((.........)))))).))))))).........((((((.....(((..................)))...))))))...........(((((((.(((.(((((((((((((.....((((((((.....)))))))).)))))))))))))))).)))))))..))))))))((((((((((...((.(((((((((.....)))))))))))..(((((((((..((((.....))))..))))).)))).....((.((((...........)))).))...))))))))))..(((((........))))).)))))))).)).))))))...))))))...))..)).))))...
Thermodynamic Ensemble Prediction
..((((((..(((((.((..((....))..)).)))))(((((((...............}}})))),.....})))))((((((((((({.(((((((((((((.(.({.,...}),},)||{.(((((.((((..(((.(((((((((((((.(((..(((((((((((({(.({.((.((((,,((((((,.({.(((((((((....))}.(((((((...))))))))))))).{(((..(,{..(((((((((((((.........)))))))))),|.}}},}}}))}}(((((((...(((((((....))))))))))))}}.{{{{..({(((((((.({(.((((((,(,,(((((((({,|,{((((((.{{{{{{.(((((,,((((((.(((..((((((((((((((.((.,.((...((((((.((((.{.(((.(((...(((....)))))).)))..,.))))(((((.((((.((((((((.((.....((..,.(((((....))))),)).....)).))))))))..{({(((((((((((..((((((((...(((.((((((((((((.((((((((((......,{(((({....))))}).....)}))))))).))))))}}))))).)))..))))((((((..,(((((.(((.((((....((((((.((((((,.((((((..((((((.((((((((.((((((((((((((....({.....}})))))))))){{{..(((((((.(((((.(({,,,.(((,,,}}},)))}}}.....))...))))).)))))))..))).,,..)))).))))))))..((({{(((....}))),.)))...(((.{({.(.(({...)))}},,})))(((((((((.,((((((((....,.{.((((.(((((.......})))).)))),.(((((,{,.{|||||.,}}}}}}}}||.((.({({{...........||,(({,,{{{{.{((((((({...{(((((((((((((,...,|||,{{{{||,((((((((...))).))))),((((((((.(((.((((...)))).))).}}))))))),...((((.(((((((....)))))))))))........,{{,.,{(((((,,..,,,.,,....,,,,,}}}},...{{{,,...........}}}}))})},|}))))))}...)))))))))))}||,,,,}}}},,,,...})))}}}}}}},,)|((((((({.....{{{{{,,||||||{{{....((((((((.,...(({{{{((..,,....,|,.}}}),....(((((.(((.....(((.((.((({{{..,,.((((((((({(({(.(((..(......)..)))))))))))))))))))))).)).}))...))).))))){{........))....))))...)))))))},..))))},........,|})).}}))}...}}}}}}}((((((...)))))).)))))))),)))..))))))......))))))...})))))))))))...))))))....))))...))))))))))))))((({{((....)))))).))))))))))))))).)).,(((((((((((....,||({......,||...|}}}....))))).....))))))}.........((((((((((.......))))))).))){(((,{(((((((((.....))),...}))))).).)))})))).)))))........(((..((((((((..(((.((,....)),)))))))))))..)))..((........)).......(((....,}))},,)))))).))...))..)))))).)))))).))..))).))))))........(((((....))))).{{{.,.......}}}....{{{{|,,,))))),,,}...,|,.....{{{{{{|{{{{...,,||{,{.,,(((((.((((.((((({....)))))),(((((((...}))))))|((((.(((...)))))))}.....)))).)))))..|})|,,,..}}|||||||}||{{..,,}}..{((((((((((((.{,((((((,{{{{...{((((....))))},||{{{||,,}|,{(((((.,,{{.((.,......}},}}}..}))))},,...|||}|||....((({...,....}})),.,(((({...(((((........))))).,))))),},))),|||||,|((({{.{{{,...,((((((((((((((.(((..,,,(((((((((({....}}}},.,,,.,)))))).,}...))).)))))....))))))))}{,{,|,}}.,,}})})}}},}}}}},}},,))))))))))))}}}}}).}}}}}}{{|{,|||.,,,.}}}}}}),,,,|{((((((((((....(((((..(((((((((...........,.{{{(.{{{((((..((({{(((..(((((((.(((((((.{{{{...,,,{,.....,|||{{|{...,,((({{,...((((((((((.....))),})).)))).{{.,.....,)).,.}}))}}|},,}))),,.}))}.)))}})))...))))))).................))))))).)))).)}}.)))))))},)))))..)))}}....{{((((((.....,}}}}}}},,.}},,,}...........)))))))))))((((...))))...{((((((((((((.((.......,,.(((((((((...)))))))))...,..)).))))))))))))}...}))}))),},,,}))))))))..}..||||||,|}}.,||},.|}}}},...,))}}..{((((((...{(((((({{(((((((((((((.(((..{(,,{.(((((((((.....)))))))))..,{(((..,,,,,....,)))))),,))}.)))))),.})))))))))))))}))))))}..,)))))..}}}}{(((((....)))))|((((((((((..,({,{({.{{{.{{{,..|,},,,,,,{(((((((...........))))))))}}.,}},)))..)))}})))))),))..)))))).,,}.)))),)).)).||{{{{(.(((((((........(({....}))))))))).}})))).})),}))))).....)))..)))....))))))))..))))).)))..))))))))),,,{(((((((((((((.((((((,.,(((.(((.(((({....))))).))}))),,,.....|,||......,,,)).))))))..)))))))}.(((((((....(((....)))...))))))),{{,...}}}}}))))))))).),|,......},{((((((((..((((((((((....{(((((..((..(((..((((......)))).)))..))..)))))}((((.(((((.(((((((((((((,{{{{.,(((..(((((...{{.((((((,....,(((((((((...((((....((((((.{{{,.......(({((({,(((((((,,.,(({{,(((,(({,,,..}},)}}.}|,........,||,}}}}}..,{{.....}}}.......|||||}}}}|},,}}...,,,,,,,,},}},.))))))))))....)))))))))))))))).((((((.......}))))).((((......})))...,{(.(((((({...})))))).}}.||,|,|,..((((({,(((...((((((((((((({..({{.{(((,({(.(((({{{,{{{{{{{{,,,,,....(((....))).,,,,,,.{{((((.(((..(((((.(((((((....))))))).)))))..)))..)))).}}{((((((({{,{((({....}))))}},}}}))}}}((((((((({{({,,,.((({{({....{{|,.,.})),.))))))}..((((.....)))}|||,...{,.{|||||,.....,|||||,,,.,,{,,{{((((({.{{.....}}.))))))},,}|||||||||}}}}}}}})))).}},.)))))))..))))...))).,,{{({{{{{..,|||}}}..(((((((((.(((((((((..(((.,.((((((((((..{{(((((((.((.,,,,{{|....,,.{{{,,,.((((((.((((((..........(((({((((((({{{{.{,{{.(((((((.((.(((.....{((((((((.,,...,{((((,,,...,,...(((((((.....))))))).....,,,}}}}},,..))))))})}..(((((((.,.......))))))).....,,,,,|||,......,,,,.(((((((({{((((.....((((((.(((((((........((((...(((((((....,,,(((((............)))))|{(((.|(((((((((((.(((((....({..((.((.((.(((.,.........))).)).)))).))...))))).))))))))))},,.))))}.)))))))...))))))))))))))))))))))))))))))))).)).))))))).|||||,{.....,.{||||,,,...}}}))}}..})))})}...,|,...|{{{..(((((((,........{(((((((((((.{{,.((((({((((({((({..{{....||,}}})..}}}}....,}..........,,{((((((({,.((((((((((...))))....)))))).....))),))))))))),}))))}),)))),......})))))))))))))),,)})}....)))))({((({({......})))))))))))).))))))..,|||||}|{|......},..}}}})},,.,,,,,.))))))))))})))))))))}......,,,,....{{({{.,{{{{{..,,.,,,..(((((((.((...(((....(((..,((((((....))))))............}..)))..)))...)))))))))..}},{{{{(((((({...{{{{{((((((.((((((..((((((((....(((((,((,.{({.{,.{{..{...........,))})..)),..}},)))))..))))).))))))))).))))))}.}}}}.....,{{{.{{{.{({{(((((({({(((...|,|||{|}}|||(((((...,,}})}))),}|,}|}||,,|||....)))))))}}}}}}}}})},.||.(((((({...})))))).)),},},))))))).||||..,.....,}})},}}.}}}}}||(((({.,,,{|||,,,,..}}},,}}},,,,,,)))..)))))),,)))))))))))..,,.,|||{{{{{{{|{.,,(((((....}))}},{({({,,....||||}},||,}|,,.,...,|||||}|,,...{{,,|||},..}||{|,|{(((({.{{{{.{{....}})))}.........}})))).},}}}},.....{{{{|,,.,))))......})))))))).)))))...))}))))))..,}..)))))..))))))))}......{{{{,..{{{({.((((...,.....,.)))).)))))..)))),.....))))))))))))).)))))))))...))))).)))))..))))))))}.)))))))))))...............((((((.,((,..((((((.....((((((((((((((((...........(((((((({((((((,,...{((((((.,,|,|||,,.{{||,,......}))))),))))))|{((({....}))))}.||||{{,..,|||{(({{{,,,{,.,,.,,.,||||||||{{{....,|||,||}}},|{{{.....,,...|||,|||,,||,..,))),},,,.,,,....(((((((.(((.(((((((((((((.....{(((((((.....)))))))).)))))))))))))))).)))))))..}))))))}((((((((((...{{.(((((((((.....)))))))))|}{(((((.(((.....}}}.)))))}...{{((((|,......}},,}}}}}}}........}},,.,,,..))))))))))..(((((........))))).))))))))},).))))))...))))))...))..)).))))...

Transcripts

ID Sequence Length GC content
ACCGCUCUCCUGCCUGGAAGUGCUGACAGAUCAAGGCAACAAAUUUCAA… 6430 nt 0.4149
Summary

This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]

Forensic Context

A study in mice demonstrated that the TBX18 transcript is a marker for epicardial-derived epithelial cells, mapping to a specific cluster identified through single-cell RNA sequencing in a model of arrhythmogenic cardiomyopathy [Yuan et al. DOI:10.1161/CIRCULATIONAHA.120.052928]. In a rat skeletal muscle contusion model, the TBX18 mRNA was one of 13 genes selected in a stepwise Fisher discriminant analysis model to classify wound age into three temporal groups (control, 4–24 h, and 28–48 h post-injury), contributing to a multivariate statistical framework for wound age estimation [Du et al. DOI:10.1007/s00414-018-01990-2].