Basic Information

Symbol
TBX21
RNA class
mRNA
Alias
T-Box Transcription Factor 21 TBLYM T-Bet T-Cell-Specific T-Box Transcription Factor T-Bet T-Box Transcription Factor Expressed In T Cells T-Box Transcription Factor TBX21 Transcription Factor TBLYM T-Box Protein 21 T-Box 21 TBET T-Box Expressed In T Cells IMD88 T-PET
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_013351.2
Sequence length
2583.0 nt
GC content
0.5962

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1075.80 kcal/mol
Thermodynamic ensemble
Free energy: -1121.00 kcal/mol
Frequency: 0.0000
Diversity: 717.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((..(((.((((((((((((...(((((....((((((((((((.......)))......((((((((((.((((....)))).((((((....))))))(((((((((.(((..((((.(((.(((((((((((((((...(((.(((((.....))))).).)).((((((((((((...((....))...))).....))))))))))))))))))..).))))).)))..)))).)))..(((..(.((((.((...)).)))).)..)))..)))))))))))))))))))((((((((.(((..(((.((((((((...((((((.(((((((..(((((......)))))((((((..((((.(..((.(((((((.....))))))).))..).))))..)))))).((((((((((...)))))............(((((........))))).)))))..((((.((((.(((((((((((((.(((((.(((...))).)))).....).)))).))))))).)))))).))))....))))))).)))))).(((((((.((((((.....))))))...))).))))..)))))))).))).....))).)))))).))...(((((((((((((.((((.(...........).))))))))((((((((((((.((.....))(((((.(((((....)))))))))).....((((((...((((((......)))))).))))))..(((((((((....(((((.(((((((.....(((((.((.((......)).)).)))))((((((.((((.....((...((((...)))).))...))))))))))))))))).)))))..(((((....(((((...((((.....))))...)))))..)))))..........)))))))))....(((.((((......))))..))).)))))))(((..(((.(((((((.......((((((((((((.....(((((......))))).....))))..((((((((.((((.((.........))...((((........))))...........)))).).).))))))........((.(((....))).))(((((((((((((.....(((((...))))).....(((((((....((((((.(((.......(((((....)))))((((.((((((((((.((((...............(((((((.......)))))))((((((((((..(((..(((.....(((((((((((..((..(((((.(((((((.((...((((((((((..((((((......(((.((((((....((((((..(((((....))))).)))))).((((...((.....))))))......)))))).)))))))))...))))))))))....))..))))))))))))..)).....))))).))))))(((.(((..((((.((.(((((((.....(((((.(((((...((((((((.....)))))....)))..)))..)).)))))....))....))))))))))).))).)))(((((((.....)))))))..))))))....(((((...((((((.((((.((((.....((((((.(((((.((((.......((.(((((.((.((((((.((........)).)).)))))).))))).))..((((((.((((((((((.....)))))....))))).(((((((((...(((((((((((((.(((.((((((((...................)))))))).((((((......))))))........(((((((.(((((.(((((..(((....)))..))).)).))))))))))))....))))))))))))))))((((.((.((((.((((.((......)))))).)))).))))))...)))))).))).((((((...)))))))))))))))).)))))......(((((.........).)))).))))))...)))).)))).))))))......(((((......))))))))))...(((.((.....)).)))..)))))))))))))))))))).))))...))))))).).)))))....))))))).)))).))))...)))))...(((((.(((((((((((((......((.........)).......)))))))))).....((((((((...(((((((((((((......)).)))))))))))...)))))..)))..((((((((........))).))))).))).)))))))))))))...))))))).)))..)))))))).(.((((((....)))))).))))))))))....)))))))))....)))))...)))))))))))............).)))..))).((((((.....((((((((((...(((((.........))))).))))))))))....))))))...............
Thermodynamic Ensemble Prediction
...,.(((({{((({(((((({(({((,,,({({(,,,.{(((((((((((..,,,..}})},....(({{((({{{.{{{|.,..)))),{(((((....)))))|(((((((((.(((..((((.(((.(((((((((((((((...(((.(((((.....))))).).)).((((((((({{{...{(,,..|}...,}).,,,.))))))))))))))))))..).))))).)))..)))).))).,(((..(.((((.((...)).)))).)..)))..)))))))))))}}}}}})}((((((((.(((..(((.((((((((,,{((((((.(((((((.(({(((,,.,..}})))|||((((((({,{((.((,(((((((.....))))))).)),.)})},)})))))||{{.({{({{|,..,({.({...{((......||,||,.},},})))))))))).,,.((((.(({((((((((((((((({,((((.(((...))).)))).....),)))).))))))).)))))).)))).,}.))))))).)))))}.{{(((({.((((((.....))))))...))),))))..)))))))).))).....))).))))))})).,.((((((((({({{.((((....,........},}}}}})}}{({(((((((((.{,..{{{||(({((.(((((..,,)})))))))}.....((((((...((((((......)))))).)))))),.{({((((((.,{,(((((.(((((((.....(((((.((.((......)).)).)))))((((((.((((.....((...((({...}))).))...))))))))))))))))).))))},|((({,....(((((...((((.....))))...|||||..}}}})..,,,...,.})}}}}}}}....|||}||||}}....}})}..}}).))))))}(((..(((.(((((((.....,.((((((((((((.....(((((......))))).,...)))).,{((({{{,.,,...||},}.,,{{{{{{,.{{{{........}})}....,{||,{,|,},.)}),)))}}}.,,,,...((.(((....))).)),{,,,,,{{,........(((({...})))).....(((((((..,.((((({.(((..,....{((((....))))}((((.((((((((({{((((..............,|((((((.......)))))))((((((((((.,,((,.,,{{|..(((((({,{{((..{({,(({({((((((((.((.,.((((((((((..((((((......(((.((((((....((((((..(((((....))))).)))))).((((...{{.....)}))))......)))))).)))))))))...)))))))))).,..))..))))))))))||,{||{{,{((((.((((((((...{.((((..(((((.(({.,(((((..((((((((((..(((((((((((({.{(.({.((((({(..,{{...}}))),..))}).}})}.)))).)))))})))).)).)).))),))}..))))).}.)))))).)..)))).,...))))))))..)))))})..,}}))}))))}.|.|||},.|,...((.(((((.((.((((,({((........)).)).)))))).))))).))..||||{{.((((({{(((,,...}})))}|..))))).{{((({{,,.,||,(((((((({(({(,(,(({({(({,,{,..,,...{,,,,{{,,|||}}||,(({(((,,,,..||||||,..,....(((((((.(((((.({(((..(((....)))..))).)).))))))))))))..,})))))))))||}}|||((((.((.((((.(((((((......)))))).)))).)))))),,.,,,,,,..,,.{(((((...)))))))))))}|||||||{||,}|..,||{|.}},,..}}).,,)),},||{|||{|||,.{{{{|.,.,)))))..)}|||,|}}}}..))}}}))))}.},|||}{|.....)).,,,.,)))))))))))))))))))).))))...))))))},}.)))))....)))))))..,}}.,}},...,,}||{{.,,,,,}}})|||||||||||..,,.{({,{,......,,.,,.||}}}}}}.})),....{{{{((((...(((((((((((((......)).)))))))))))...))))}.,}))..{(((((((........))).)))))}))).},...))))))))...))))))).)))..)))))))).{.((((((....)))))).)))))))))).,}}))))))))),...}})}}...}}}}}}}}}||........}}},)}))),.}}}.{{((((...,.((((((((((...(((((.........))))).)))))))))).,..))))}}.......})))),..

Transcripts

ID Sequence Length GC content
AGUGACAGCGGCCCGCUGGAGAGGAAGCCCGAGAGCUGCCGCGCGCCUG… 2583 nt 0.5962
Summary

This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human ortholog of mouse Tbx21/Tbet gene. Studies in mouse show that Tbx21 protein is a Th1 cell-specific transcription factor that controls the expression of the hallmark Th1 cytokine, interferon-gamma (IFNG). Expression of the human ortholog also correlates with IFNG expression in Th1 and natural killer cells, suggesting a role for this gene in initiating Th1 lineage development from naive Th precursor cells. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the TBX21 as a potential diagnostic biomarker candidate through weighted gene co-expression network analysis of peripheral blood from acute myocardial infarction patients [Zhang et al. DOI:PMC8129354].