| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGACAGCGGCCCGCUGGAGAGGAAGCCCGAGAGCUGCCGCGCGCCUG… | 2583 nt | 0.5962 |
This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human ortholog of mouse Tbx21/Tbet gene. Studies in mouse show that Tbx21 protein is a Th1 cell-specific transcription factor that controls the expression of the hallmark Th1 cytokine, interferon-gamma (IFNG). Expression of the human ortholog also correlates with IFNG expression in Th1 and natural killer cells, suggesting a role for this gene in initiating Th1 lineage development from naive Th precursor cells. [provided by RefSeq, Jul 2008]
A study in humans identified the TBX21 as a potential diagnostic biomarker candidate through weighted gene co-expression network analysis of peripheral blood from acute myocardial infarction patients [Zhang et al. DOI:PMC8129354].