| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACGCCCGGUGAAUUCUAGAGGCGGCGGAGGGUGGCGAGGAGCUCUCG… | 4733 nt | 0.5248 | |
| AGACGCCCGGUGAAUUCUAGAGGCGGCGGAGGGUGGCGAGGAGCUCUCG… | 4793 nt | 0.5243 |
This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
A study in humans identified a heterozygous, ultra-rare 3' UTR deletion in the TBX3 gene (c.*889_*891del) as a candidate variant for sudden unexplained death (SUD) predisposition, which was validated by a dual-luciferase reporter assay to significantly increase upstream gene expression [Wang et al. DOI:10.007/s00414-024-03329-6]. In a separate human study, the TBX3 transcription factor was identified as a direct target of Wnt/β-catenin signalling within fibroblast subclusters of the corpus cavernosum [Zhao et al. DOI:10.1038/s41467-022-31950-9].