| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCGCCCCUCCCCGGCGGGCCAGGGGCUGGGACGCCCCGGCGGAGCAG… | 2985 nt | 0.6137 |
This gene encodes a member of the T cell factor/lymphoid enhancer factor family of transcription factors. These transcription factors are activated by beta catenin, mediate the Wnt signaling pathway and are antagonized by the transforming growth factor beta signaling pathway. The encoded protein contains a high mobility group-box DNA binding domain and participates in the regulation of cell cycle genes and cellular senescence. [provided by RefSeq, Nov 2010]
A study in mice demonstrated that the transcription factor TCF7L1 was enriched in serotonergic neurons during the post-addiction phase and in dopaminergic neurons during the pre-addiction phase of nicotine self-administration, as identified through single-nucleus RNA sequencing and SCENIC regulatory network analysis [Fan et al. DOI:10.1016/J.Jgg.2024.08.009].