| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCCCGCUGCCCCACGUUCUACCUGCUCUCGCUUGUGAACUAGCCUC… | 3606 nt | 0.4368 |
This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]
No relevant information is available at the moment.