Basic Information

Symbol
TCN1
RNA class
mRNA
Alias
Transcobalamin 1 TCI TC1 Haptocorrin Transcobalamin I (Vitamin B12 Binding Protein, R Binder Family) Transcobalamin I Transcobalamin-1 Haptocorin Protein R TC-1 HC TC I
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_001062.4
Sequence length
1486.0 nt
GC content
0.4240

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-387.70 kcal/mol
Thermodynamic ensemble
Free energy: -419.09 kcal/mol
Frequency: 0.0000
Diversity: 333.41
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.(((.(((.(((((((.(((.((((.......)))).(((....)))((((.(((((...((((.(((............))).)))).......(((((((((((((...................((((((((...((((((.................(((((((......(.(((((.(((.(((((.(((.((((.((..(((((((.(((.........)))..........((((.......))))...(((((.((.....)).)))))(((..((((((((....)))))))).)))......(((((((.((..(((.((((((....((((.....))))...)))))))))..))........))))))).......)))))))..))...))))......))))))))))).))))))))))))).......(((((((((((......((((.((((((.(((.((..((((.....)))).)).)))..))))))..))))................(((((((......)))))))((((((((...((((((....))))).)...)))))).))((((((...........(((((((((((.......((((.........((((((..((((((((..((...((((((((((.....)))).))))))((((....))))((((((((.......(((((((.((....)).)).))))).(((.(((((..(((.....))).)))))))).)).)))))).................)).))))))))..))...)))).....(((((((...((......))...)))))))((((.........))))..))))(((((((.(((........))).)))))))..(((........)))))))))))))).((((((((((.((((....((((.((((......))))(((.....((.((((((.....(((((((((........................))))))..))).(((((....)))))....)))))).)))))....(((((((((.(((((..((((((((.......))).............((((....)))).)))))...)))))((((......(((((((((((.....))))..)))))))..))))..........)))))))))...))))....)))))))))))))).......))))))..)))))))))))..))))))...)))))))).......((((((.....(((........((((((((.......((((...((((((...........))))))))))......)))))))))))....))))))))))))))))))).))))).)))).((((.(((...))))))).))).)))))))))))))))......(((((((((....)))))))))...
Thermodynamic Ensemble Prediction
{(.(((.(({{(((((((.((((((((......,|..(((((....))))).|,,})))}}}}..........,,|.......{{{,,|..,{{,(.(((((((((((((.........,{(,,....(((((((((..,{...((({...})))...,,)))))))))....,},|,(((((.(({{(((((.{{{.......(((((((((((,,,,,,......,,),,......}}},,)))))))}.,,....{{{{{.{{...,,)}.}}}||{{{..((((((((....)))))))).}))}}.,,.||{{{|||(({.(({.((((((....((((.....))))...))))))}))..)),},.....,}|||}|........|||,,},,.....,}}.......))))))))))).))))}{|||.,,(((.{((.((((((((((({{{{.,((((,((((((.(((.((..((((.....)))).}}.))}..)))||||,,}}}....,,|||.....,,|{(((({......}))))))|||{{(((||||{||{|,}}.))))),}}..,))))),}}{(((((........{,.(((((((((((......,((((.........((((((..((((((((..,,...((((((((((.....)))).))))))((({....})))((((((({..,,,,,,{{{(((,((,..,|,.,}.}}}}}.,,{.{{{{{..{||,,,.,))),})))))}}.)).))))))..,,.........,,,.}}.))))))))..))...)))).....{((((((...((......))...))))))}((((.........))))..))))|((((((.(((........))).))))))}..(((........)))))))))))))).((((((((({{((((....{{{,.((((......)))){{{.....((.((((((.....{({((((((........................))))))..}}}.(((({....}))))....)))))).))}||....(((((((((,(((((..(((((,{{......,|||,....,,......,{{{..,,)))),))))).,.)))))|.((.(((..((((((({{((.....)}))..)))))))})).))..........)))))))))...}))}....))))))))))))))...,,}.)))))},})))))))))))...)))))}.|||..|||}.,,,,.,(((((({...{((,{{.......,,{,{||,,,,,|,,||(,,.((((((...........))))))})))})}}}.)))),}),)))...,)),,,,))))))))))))),))},,.||)}|((((.((,...,)))))).}}},))))))))))))),}......(((((((((....)))))))))...

Transcripts

ID Sequence Length GC content
GGUACACUGUUGGAGAGAUGAGACAGUCACACCAGCUGCCCCUAGUGGG… 1486 nt 0.4240
Summary

This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This protein is a major constituent of secondary granules in neutrophils and facilitates the transport of cobalamin into cells. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans analyzing blood samples from burn patients identified the TCN1 as one of 19 center genes commonly differentially expressed across early-stage, middle-stage, and control comparisons, associating it with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0]. Another human study using skin and blood samples identified the TCN1 as a key diagnostic hub gene, with validation in independent datasets showing its significantly higher expression in burn patients and an area under the curve of 93.11% in receiver operating characteristic analysis, and immunohistochemistry confirmed elevated protein expression in burn patient skin [Yang et al. DOI:10.3389/fgene.2021.781589].