| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGUACACUGUUGGAGAGAUGAGACAGUCACACCAGCUGCCCCUAGUGGG… | 1486 nt | 0.4240 |
This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This protein is a major constituent of secondary granules in neutrophils and facilitates the transport of cobalamin into cells. [provided by RefSeq, Jul 2008]
A study in humans analyzing blood samples from burn patients identified the TCN1 as one of 19 center genes commonly differentially expressed across early-stage, middle-stage, and control comparisons, associating it with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0]. Another human study using skin and blood samples identified the TCN1 as a key diagnostic hub gene, with validation in independent datasets showing its significantly higher expression in burn patients and an area under the curve of 93.11% in receiver operating characteristic analysis, and immunohistochemistry confirmed elevated protein expression in burn patient skin [Yang et al. DOI:10.3389/fgene.2021.781589].