Basic Information

Symbol
TEAD1
RNA class
mRNA
Alias
TEA Domain Transcription Factor 1 TEF-1 TCF13 TEA Domain Family Member 1 (SV40 Transcriptional Enhancer Factor) Transcriptional Enhancer Factor TEF-1 Transcriptional Enhancer Factor 1 Transcription Factor 13 Protein GT-IIC NTEF-1 TCF-13 TEAD-1 AA Atrophia Areata, Peripapillary Chorioretinal Degeneration TEA Domain Family Member 1 REF1 TEF1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_021961.6
Sequence length
9417.0 nt
GC content
0.4301

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2711.70 kcal/mol
Thermodynamic ensemble
Free energy: -2893.86 kcal/mol
Frequency: 0.0000
Diversity: 2667.35
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....................((((((((((((.(((((.(((((.((((((......)))(((.((((((.(((.(((((.(.(.(((((((((((.((((............((((.............))))))))....)).)))))))))).).)))))))))))))).)))....))).)))))...)).))).))).((((((.(.(((((..((((((((((((((((((....)))).))))..(((((.((((((((((((((((((((((((((((((((((((.(((.(((((((((((((((((...((((((((((((((...))).)).((((((((.((.((((((((...(((...((((((.((((..(((.(((.....))).))))))))))))))))...)).)))))).)).))))).)))..((.(((......))).))........(((..(((........)))..)))......(((((.....)))))..........(((((.(((...))).)))))......)))))))))))))))))...(((((((((..((((((((((((((((.(((......)))..)))........((((((...)))).))(((((........))))).....(((.......)))......((((((....................)))))).))))))))))))).((....))(((...))))))))))))..(((((((((..(((.((....))..)))......(((((((((((.((...........)).))))))).))))...))))))))).....((((((((.(((..(((..(((.((((((........))).))).))).......(((((((((..((((((((((....))))))).)))...))..))))))).((((((...((((.(((((.(((.(((((.((((((..((((((.......((((((((((((((..(((............((((.(((.(((((((...............)))))))))).)))))))..)))))))).)))))).....)))))))))..(((..((....)).)))..)))...))))).)))))))).....)))).....))))))...))).....))).)))))))).))))....)))))..))).))))).)))))))))))))...))))))((..((...((((..(((..(((.((((((((.....((((.......(((...(((((.((((.....(((((.............((((((((..(((((((((........((((((.(((.(((((((((..((((.(((.(((.((((......)))).))))))))))..........(((....(((((((....((((.((((((..((((((((.........(((((.....((..((((....(((.((........(((((((((((((((((((.((((...))))(((((((...(((((((((((((((((((((((((((.............((((((....)).))))((((((((((((.((((.(.((((((.....((((((((((.(((.((.((((((((..((((((((.........(((((((.(((.(((((((..((((((((((((((......(((....)))....((((((((....((((((((......(((((.((((....(.(...((((.(((((........(((........)))......))))).))))...).)...)))).)))))..))))))))..)))))))).....)))))))...))).))))..))))))).)))((((((((....)))))))).....)))))))...((((((((((................((....))..((((((((((..((((((.....))))))...(((((....)))))....((((((.((((((...)))).)).))))))((((((((((((((...((((...((((((((((((((((((.(((...((((((....(((((...(((......)))....)))))......)))))).(((..((((...))))..))).))).)))).......(((((.....(((((((.(((((((....(((........)))..))))))).)).)))))...))))).))))))))((..((((....))))..))........................(((((........))))).........((.(((((((........(((((((..(((((..((((..........))))..))))).))))))).(((((((..((((..(((((.((((((.....)))))))))))..)))).....((((((((((((.(((.(((....((((.....)))).((((((((((.((((.(((((((((((..((((...................)))))))...)))))..))).))))..))))....))))))...))).))).)))))))))))).)))))))...(((((((.(((((.(((((((........(((((....))))))))))))))))).))).))))))))))).))((((((.........)))))))))))).))))...))))).))))))))).............)))))))))).))))))))))))).))))))))))))))).)))((((((((((((((((.(((.............)))..)))))))))).))))))........((((((.....((((((((..((((.(((((((((((...((((...))))(((((((((......((........))..........(((...(((((((((((....))))......)))))))..)))...))).)))))).((((((.............((((((((((..((((((........))).)))....)))(((((((((((....(((((((....)))))))..))))))))))).........(((.(((((.((((.....))))))))).))))))))))(((((((((((....))))))...(((((((((......)))))))))........)))))))))))..)))).))))))).))))........(..(((((((((...(((((..(((((...((....)).))))))))))..)))))))))..)...(((.(((....))).)))((((((......))))))......))))))))....)).))))((((..(((((((((.(((((((..(((....(((((((.(((((((..((((...))))))))))).....(((((.(((.....)))))))).........(((((((.....((((.(((((((((............)))))..(((((((....))))))).................)))))))).....)))))))...))))))).))).))))))).))))))))).............)))))))))).)))))))))).).))))))))))))))))......((.(((((((((((((((.......(((((((.((((((((.(((.............)))..)))).......((((.....(((((((....(((((((((.((((((.......(((((((...((....(((((((((...((((..(((......)))...((((......(((((....))))))))).((((....)))))))).))).))))))..)).))))))).........((((..(((((.......)))))..)))).(((((.((((...)))).))))).)))))).))).))))))...)))))))....)))))))).))))))).....))))))((((..(((((((((((.........(((((...)))))((((.(((((.........))))).)))))))))).)))))..)).))..((((((((.((.....((((.((..((((((((((((((...((((....................)))))))))))...((((.(((((((((.((((((.((.(((((((.((((...(((((....((((((((....))))))))))))).)))).(((((..........))))).....((((((..(((....))).)))))).(((((((.(((((.((..((((....))))...((((((...............))))))...............(((((((.((((((((....((((((....(((((((.........)))))))..(((((((..........)))))))((((((....(((((.((((((.......)))))).)))))((......))...........(((.(((((....................))))).)))..............((((....)))).......))))))....((((((((((((.((((..(((((((.(((.(((.........))))))..(((((.((((((((((...(((((((...)).)))))....))).)))))))..)))))...................)))))))..)))).)))))))))))).....(((.(......)))).....)))))))))))))).)))))))...............))))))).)))))))..(((((.(((......)))(((((((....)))))))...(((.........)))..)))))...))))))))).)))))).)))))))))..))))(((.(((........)))))).))).)).))..)).))))....)).))).))))).....(((((.((((((((..(((((....(((((....)))))....)))))..))))...)))).)))))..))))))))))).(((((...)))))......((((....)))).(((((((........)))))))...((((...))))((((....))))))))))))....))).))))).........)))))))))))(((((((....((((((((((...(((...(((........))).)))...)))))))))))))))))..(((((.............(((((....((((((......)).))))...))))))))))..............))))))).....))))))))))))))....)))))........)))))......))))..))))))).......))))).))).....)))))).))))))))))))))...)))))))))..)))))))))............(((((((..........)))))))..((((((.(((((...((((....(((((((((..((((((((((((.((.....)).)))))).(((((((((((((((((((((..(((((((((((..(((.((((((((((((((((.........))))))..(((((.(((.((((.(...((((((((((((.(((((((.....((((..........))))...)))))))((((((((...(((..(((((.(((..........((((((((((.(((((((((.((..((((....(.(((((((...(((.((((..((((((....)))))).......)))).))))))))))).))))..)).))))))).))))).....))))))).........((((((..(((.((((((((((...........(((.(((....))).))).....((.((((((((((((....)))))....((......)).(((......))))))))))))(((((....((((........(((((.((((((.((.(((((((.......)))))))..))))))))))).....))........))))..))))).....((((((......))))))..............(((((...)))))...............((((((((.((((.((((.....))))..)))).))).)))))...((((((...........))))))..........)))))))))).)))..))))))...((((((((((...((((......(((((((((((..((((((((((..((((((..((((((((..((((((((.((((............))))))))))))..)))))))).(.((((((((((((..((.(((......)))))))))))))..)))).).(((((...(((((......((((((.(((((((........)))....)))).)))))).....))))).)))))...................))))))..(((((((.(((((((((((((((..((......))(((((((........(((..(((((((((((((...))))........)))))))))....)))........)))))))..)))))).........)))))))))..((((....)))).........(((((((.....(((((..................((((((((((...(((((((....)))))))..)))......)))))))...((((((((((......((((((....(((((.((.(((((.....(((((((((...((((....)))).(((((((((((.((((((((((((.((((((.(((......((((....))))....((((((((..((((.((.......)).))))..))))))))....(((.(((.......(((((((...(((..(((..((((((((.(.((.........((((.((((((((((((((((((((...((((..(((((...((((((..((((((..............)))))).....))))))((((.((((..((.(((......))))).))))..)))).........)))))..)))).(((((((....)).))))))))))).)))))))))))..)))))))........)).).)))))))))))..)))..))))))).......))).)))............).)))))))).)))......((.((((....)))).)).)))))))))..))))))))))).....)))))))))....))))))))))))...)))))).......((((....))))..(((((.(((((.((((..((((((..((((.(((...(((((....((....)).....)))))))).)))))))))).....))))...)))))...)))))..))))))))))(((((.....((((((((((((((..((((............))))))))))))))).)))....))))).))))).))))))).))))))).))))))))))...))))))).))))......))))..))))).)))))...(((((.......)))))))))))))..)))...)))))))).))))))).......)))))...).)))).))).))))).............)))))))))).)))..........((((((.........))))))...(((((...((((....))))...))))).((((((((.((...((..((((((((.............((((((...)))))).(((.((((..(.....((((((......(((((.......)))))))))))....(((.....))).)..)))).)))..))))))))..)).....))..)))))))).......))))))).....((((....))))..))))...)))))))))).................((((...)))))))))))....))))...........((((......))))........))))))...))))).))))....))))...)))))..))))))((((..((.(((((((((((((((((((.............)))))..))))..((((((((.(((((............((((((.((((((((((((((...((((.((((((((((((((((((....)))))))).....((.((((.......))))..)).(((((((...)))))))..))))))....))))..))))...))))).......))))))))).))))))..(((((((((...(((..((((....(((((..............)))))................................((((((...........(((((((((((........))))......)))))))))))))..................)))).....)))...)))))))))............................))))).))))).)))................((((...........))))....(((....)))..(((((......)))))......)))))))))).))...)))))))..)))))).)))).)))))))))....)))))))))..))))))))))))))).))).)))))))))..))........))))).))))).)).))))).((((((((((....)))....))))))))).)))))))).))))).).))))))..))))))))).....(((((((.(((((((((.(((((..((((((.....(((((.....))))).........((((((((((((.....))))).)))))))..))))))..)))))(((((.((.((((......)))).)).)).)))..((((((((.(((((.....(((((.(((((..((((.(((((...))))).))))..)))))))))).((((((((((((....))))))))))))......((((((.(((((..((.((((.....((......)).....))))))....))))))))))).........))))).))))...))))....(((((((.((..((((((((....)))....))))))).)))))))..((((((((....(((((((((..((((.............))))...))))))...)))...)))))))).........)))))))))...)))))))...
Thermodynamic Ensemble Prediction
.....................((((((((((((.(((((.(((((.((((((,...,.}}},((.((((((.(((.(((((.(,{.(((((((((((.((((.....{,.....({.,....|}.......,})}))))....)),))))))))))}..)))))))))))))).))}....))).)))))...)).))).))){((((((.(.(((((..(((((((((,((((((((....)))).)))).{({,(({(|,,((((((.(((((((((((((((((((((((((.(((.(((((((((((((((((,..{(((((((((({((,..|||,||,({{(((((.((.(((((((,,{,(((...((((((.((({..(((.(((.....))).)))})))))))))))).,}),,)))))).)).))))),|}|,.,({({{,,{{..,||{|,..,{|||,{{(||({|,,......|}}||)}}......(((((.....)))))..........((((({((....}))})))))......})))))))))))))))}...,(((((({,..((((((((((((((((.(((......))}..))).......,{{{{{{...)))),)}(((((.|......)))))}....{{{.......},}..,,..{(((((......,,....}....,..)))))}.))))))))))))).|,....}|{((...))))}}}})))},.(((((((((..(((.((....,}..)),,,....(((((((((((.((,.........,)).)))))))},))).,.))))))))).....((((((((.(((..(((..({(,((((((.,,.....}||,}},.}}),,.,||.|||||||}|,.||{(((((((....))))))).,||{........))),,.((((((...((((.((({(((((.(((((.((((((..((((((..,....((((((((((((((..(((............((((.(((.(((((((..........,....)))))))))).)))))))..))))))))},))))).....}))))}))).,{{,..{{....)}.))}..)))...))))).)))))))).....)))).....))))))...))).....))).)))))))).))))....))))),.))),))))).)))))))))))))...))))))).{(((.....))},}}}}})}))})}}}......((((({{((((.(((((((({{((.(((({,...{(((,..,,,,,..,,,.,((((,{,..{|||||(((,,((.{((((.(((.({.,(((((,,,,..,|||,||{.{{{.((((......)))).}}}.))))),.}}}}}.}}}}}}....||||,,|}}}}(((({((((,,.......}}}}}.}}},..|}}....,}}}}}}|{{,.,.{{{{{({,{{{.{{{(((((({{(((((({{{{,.(((((..,|((((({{{..{{(((({{{{{{{{{{{((((({{{{|||||...,....,,{((((((....)),,)))||{{{{{{{,,,,({{(,(.((({(({,,,,((((({{{{,..||}|.,{|||}}}},,,,,,...}}}}}}..,.{((((((.,{{.(((((((..((((((((((((((......(({....}}}....((((((((....((((((((,.....(((((.{{,...,,|,,,,.{{{{.(((((......,.(((........))),.....))))).|||||||..,.}}})}}.})))},.))))))))..)))))))).....)))))))...))).))))..))))))).}}|((((((((....))))))))}..,,)}}}}}}.||(({{{{||||.,,,,,,...........},..}},,|||||{{{{{..|||||,.,{{{||}}}),}}|||||,},.})))}....((((((.((,((,...,})).)).))))))((((((((((((((,,.((((...((((({((((((((((((.(((,..{((({{...((((((((.,.,..}}}})))}..,|||,.,,,.,,}}}}}}.(((..((((...))))..))).}}).)))).......(((((.....(((((((.(((((((.,,.{{(........))),,))))))).)).)))))...))))).)))))))){{..((((....))))..}}.....,{{{{,..........,,,{{(((,,.,,,,,}}}}}........,}},},}}}}}..,,},,.(((((((..(((((..((((..,,....,,))))..))))).))))))).(((({((((((,,.,{((({.({{{({.....}}})))}))))..,,},......{((((((((((.(((.(((...,(({{.....}}}}.((((((((((.{(((.(((((((((((..(((({.{{{........}}}.,.)))))))...)))))..))).)})}..))))....))))))...))).))).))))))))))))))))))))...(((((((.(((((.(((((((........{{{{,....}}})})))))))))))).))).)))).,......}||{{{||.........}})))})))))).)))),,.))))).))))))))).,,,,,.......)))))}}))),))})))))))}}},,,,..,,,,|{{....))|,{{{{({((({{{{||.|||,,,,,,,.{{{{{|||{{|||||||,},.,,,,,,)}}}}}}}((((((,....(((((((({,((((,(((((((,,{{...{(((,.,||||(((((((,({,...,({.{{,....|,.,{{{{{{{{((({.{(((((({{(({....||}}...,,,},,,,))..}}}..{||,,||}||,{((((((.,,,,,,,,,,,,(((((({(((..(({(((........))).))}..,.)))(((((((((((....(((((((....)))))))..)))))))))))..,...,,.{{{.((((,{((((.....))))))))).})),})}}}}(((((((((({....)))))),,,(((((((((......))))))))).....,},))))),,}},,..||}},|}||}}},||||{{{{,{{{(.,{((((((({...(((({.,((((({,,{{...,|,.|}},|||}}|..)))})))))..}...{((,(((....}}}.}}}((((((......)))))).....,}}}}}}}}.||,},,{||,,{{|},((((((((({((((((({(((,,{{{{{|,((,.(((((((..((((...))))))))))).})).(((((.(((.....)))))))).,{{{{{{{(({{,{({...((((({(({.{{(((.,........}.})))}...(((((((({{{,||{||......,,.}}}}..,{{||.,........)))}}))))))))))).))))})))),},,}),,}}}}}..,,,......,,||{|||||}}.}}}|||}}||.|.}}|}}}}}}}}}}},.......||,||{{((((({(((((.......(((((((.((((,,,,.((((({{{.{{{{{{,,,,...|||{{...{{(((({...})))}})}.((((((((..,{{{{,.{((((,,.......(((({....})))).....,....)))}}},})}.}.)))))))).(((((((,(((((....))))){((((((((....))))..)))))))))))).......}}))},.......,{((((..(((((.......)))))..)))).||(((.((((...}))).)))},.,)))))}....})))))))....,||||...)))))))).))))))).....}}}||}((((..(((((((((((.........(((((...)))))((((.(((((.........))))).))))))))))},))))..)).}},.{{{,(((((((...,{((({{({{{((,,||{(((((((,..,{{.,,,,,...............))))))))))}.,..{{({,((((({((.{(((({.{{.{{(((({,((((,..((((({,,,((((((((....))))))))|||||{}}},,((((,..,,,}}...}}},,.....|(((({..(((....))).)))))).{((((((.(((((.({,.{{{{..,,||},...{(((({...............)))))}.......,,{,....{((((((.((((((((....((({{{....(((((((.........)))))))..{((((((..........))))))|((((((....(((((.((((((.......)))))).))))),(,.....}|...........(((.(((((....,...............))))).)))...||,,,......((((....)))).......))))))}...((((((((((((.((((..(((((((,((,.(((.........))),})},(((((.((((((((((...(((((({...,).)))))....)))})))))))..)))))...................)))))))..)))).)))))))))))).....(((.{......,)))....})))))))))))))).))))))),............},},))))).))))))}.}|||||.(({,.,,,.,..((((((,....}}}}}))...,|,.,}......,))))))))).,,)))))))))})})))),)})))))))),)))||{{||{,...,,,...}})}|||,..,,,}},})}})}}},,...{{{{{{.,,...,,,..,,.}}|,,....((((((....)))))).....|||}}|....}}..,})|||||,,|||,|||}||.}}}}}})),)),||||,...))))),,,...((({....}}}}.{((((((........))))))|,,.{{{{...)))),..}}}..))))))))}))}...,))).))))))},,,....,,))))))),}{((((((.,,,({{{((((((...(((...(((........))).)))...))))))))))))))))))))))))}}))}}.......|||||},}}{(((((......)).))))...}}||,,||{{,........,,{....,}}}|,....}}}}}))))}})))....}}}}}.......,,||||,.....,,,}.,}}},}}}.,,....}}}},.,}},,.}})))))}})},,,,,..,,)))}..)))))))}},,)).}}}}})}}}}}}}}}.,,||{{|||.....||},.,,}})))}}}|||||}|{{{(...{(({.,{,{{({({(((,,{{{(({{{{{{{||||||,,||{{,,{{{,||{{,.,{(((({{(((,,.,..|||,}}}}.,||,||{,((((||{{{|((((((.,.......)))))),.{||{{.{{{.||||,|...{||||{{(((({.,{{{((|..},,{{{{...,})},,,}||||{{||}}}})|||||||{...{{{..{||||,|{{..,,....,.((((((((((.(((((((((.((.,(({{..,.{.(((((((...(((.((((..((((((....)))))).......)))).))))))))))}.))}),,)).))))))),})))).....))))))).}}}}}}}.||,|||,}|||,|||||{||||}.}}}}}}}}.{||,|||...,)))})))}}}}}||.||||{{((((((....))))),...||,,,...}}|{,,.....|||||||||||..{((((....((((..,.....({(((.((((((.((.(((((((.......)))))))..))))))))}}}.....))..,..}..))))..))))},,,..((((((......)))))).,,,..........,{,||,,,)})),}}|....,..,,...((((((((,((({.{{,,,....,},},,)))).))).)))))...((((((...........)))))).,........)))))})))),}))..}||||,...{{||||((({,{,{{((,,,{{,(({{({{{{{(,{{(((((({(((((.{(({..((({((((,.,{(((({({(,.,,{{,......,|}}},)))}}}}}}.}})))))},))),}||||,{{||}}|}|,||},...,},}|||||||||},.{{((({{{({{{{,{(((((......,,,....}}}||}||||||,....,})))}}|)}}}|}}}.....}}}})}}}}|}...}},,|||}},.|,|}})))}{{(((,,,,,,{(((({(((((((.(((.......))).))))))).(((....}))..,{{{{(((((((({{{,,{....,}}))))))))))){{{{{{{{{{{,,,.{((((({{{{{||,|||||{,{,.{{{((({,....,,{,,,{{||||.,.,))))))),...,...,,{......,||....|||.....,,,})))}}}...{((((((....))))))},,{{|,,,.{.{{{{{..,,,(((((((({,...,,.((((((....(((((.((.(((((.....(((((((((...((((....)))).(((((((((((.((((((((((((.((((((.(({......((((....)))).,,{((((((((..,{{|,||.......}}.}}}|,,|}|)))}}.,,,{{{.{{{.......((((((|...(((..(((..((((((((.(.((.........((((.((((((((((((((((((((,,{({({....,,,...((,,,,..,.|||},}}}.}}}}{|{..{|{||,.||||{|||||{||({(((({..,.|.}}}}},.}}|{{{|||,..,,||...))....,))))}})}}}.,{{{|||,,,,)),)))},}))))).)))))))))))..)))))))........)).).)))))))))))..))).,))))))).,.....}}),))),.......,...),)))))))).)))|{{.,.,,.,,{|..,})),,.,,.)))))))))..))))))))))).....)))))))))....))))))))))))...)))))).......((((....))))..|||||.{{|||.{{||.,{{|{||||{{({.{((,,,(((((..,.(,....)).....)))))))),))))}))))),,...}}},.,,))))),,,))}},,})))))))})).,|,,,}}||{{{{,|{.|||||,.,{{..,{|||,}}},,,||}}}}}}.,},||{||||,,{|||{||{|}||,||,|||||,,}}|||..{|||||}|||{..|||||},,||||.....,|||}.,}}}}},|||||..,(((((.......}}}}},}))))))..}}}.,,))))}}},.})})))}...,,,{||}},..,),)))}.}}}}))))}.|||,,.|||...|||}}}}})),})),....,,,..(((((({{....}}.)))))).,,{{{,.,{{,((((({,...,{{{|,,,,},,,))}}}.|}},.||,.((((((((....{,.......((((((...)))))).{((.((({........,,||||..,},,|{{((.......}))))||||||.,..(({.....)}).}}})))),))}..))))))))..,}..},,}}|||||{,,,({,({.,,.}}}),,,.,))}}}}|{,{,|||{..,,,.}})))))),,)))},)}}}},.........{(({{.||..,|{||,,...,})),..)}.})))}.|{,{,,,,,,}}}},,,,,.,}}}}))}.,}))))).})))....)))),..)))))},,)))))||(({{({.((((((((({{{{((((((..,......,...))))},.||||,.(((({,,,,{{{{|.,||||,.,...{(((((.{(((((((((((((...((((.((((((((((((((((((....))))))),.....{{.((((.......))))..},.(((((((...))))))).})))))}...,))))..))))...))))).......)))))))}}.})))}},{(((,,{,(({{.,,.{{({...|}}|||,|...}}}}.,..,},)},,,.............,,..........,,,,...((((((...........(((((((((((........))))......)))))))))))))........|,....||...,|||.||{|||,,,|||||||||......{{{{{{{{......{|,..{{{|||,,.||||,.,,,,}}|.}}}})}..,,,......}}}}}}}}.,.....,,{||}}}}),),,|||||,,,,..}}}}}......)))))))))),))}}},}}}}}}.,|||,|,.,,,).))))}),,,.,}})))))))}.,,|}}}}}.....,,,)}}}}|}}}))}}}..,,)}},,,...))))))))))))).}))))).((((((((((....)))....))))))),},}))))))).))))).).)))))).}))))))))).....(((((((.(((((((((.(((((..((((((.....{((({,,...}}}}}.....,,..{(((((((((((.....}))))}}}))))}..))))))..)))))..((({(({.,,,{{..,.,|||.|{{{{{,|...,((((,(({((((,.....(((((.(((({..((({.(((({...})))).}))}..}))))))))}.((((((((((((....)))))))))))}......((((((.(((((.,((.((((.....((......)).....)))))).,,.))))))))))).,,...,,,|||||.}|,},,.|}}},,..(((((((.((..(((((({(....}},...,))))))).)))))))..,,||{|{{...,{.,{{||||}}||||}}}}}}}.})}}..)))}}}}}))),.,..))...)))))))..........))))))))}...)))))))...

Transcripts

ID Sequence Length GC content
AUUCCGAACAUUCUUAGCAUCGCUCGCGCCGCGCCGCGCCGCCUGAGCC… 9417 nt 0.4301
Summary

This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010]

Forensic Context

A study in Sprague-Dawley rats demonstrated that tibial fracture induces temporally stratified transcriptomic changes in the L4-L5 spinal cord, with bioinformatic analysis predicting the TEAD1 as a second-ranked upstream master regulator of neurodegeneration-associated genes at 3 and 7 days post-fracture [Deng et al. DOI:10.1038/s41598-025-17561-6].