| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCCGAACAUUCUUAGCAUCGCUCGCGCCGCGCCGCGCCGCCUGAGCC… | 9417 nt | 0.4301 |
This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010]
A study in Sprague-Dawley rats demonstrated that tibial fracture induces temporally stratified transcriptomic changes in the L4-L5 spinal cord, with bioinformatic analysis predicting the TEAD1 as a second-ranked upstream master regulator of neurodegeneration-associated genes at 3 and 7 days post-fracture [Deng et al. DOI:10.1038/s41598-025-17561-6].