| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGCUGCGCUUCGCGGCAGAGGCGUCUGCGGUGACAGCUCAGUCAGUU… | 2131 nt | 0.5016 |
Enables G-rich strand telomeric DNA binding activity and phosphatase binding activity. Involved in several processes, including positive regulation of non-canonical NF-kappaB signal transduction; protection from non-homologous end joining at telomere; and regulation of primary metabolic process. Located in chromosome, telomeric region; cytoplasm; and nuclear body. Part of shelterin complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in human pediatric sepsis patients identified the TERF2IP as exhibiting decreased polyadenylation in viral compared to bacterial infection samples, classifying it among candidate genes with differential poly(A) tail length variation [He et al. DOI:10.1186/s12879-025-11078-z].