Basic Information

Symbol
TGFB1
RNA class
mRNA
Alias
Transforming Growth Factor Beta 1 TGFbeta TGFB CED Transforming Growth Factor Beta-1 Proprotein Prepro-Transforming Growth Factor Beta-1 DPD1 Diaphyseal Dysplasia 1, Progressive Transforming Growth Factor, Beta 1 Transforming Growth Factor Beta1 Camurati-Engelmann Disease Latency-Associated Peptide TGF-Beta-1 TGF-Beta1 IBDIMDE LAP
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Drug abuse diagnoses

MANE select

Transcript ID
NM_000660.7
Sequence length
2780.0 nt
GC content
0.6360

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1191.70 kcal/mol
Thermodynamic ensemble
Free energy: -1242.79 kcal/mol
Frequency: 0.0000
Diversity: 496.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.(((...((((..........)))).(((((((.(((((((.((((((.(((((.((.(((..((..((((((((((..(((((.((((((..(((((....)))))..)))))).)))))..))))((.((((((.((((((((((.(((.(((((((.(((((..(((((((...(((.(((((((.(((.(...((((.(.((.((......((((((....)))))).(((((((.(((.(((.((((.((.(((((..((.((((((((((.((((((((.............))))))...(((...((((((((((((.(((((((......((.((((.((..(((((((.((((((.((..(((((...))))).))))))))......)).)))))..)))))).)).)))))))..))).).)))).))))...)))((((....((.(((..(((...((((((..((((...))))))))))....).))..)))...))....))))(((.....)))..((((..........))))((((((((((.((......)).....(((.....)))....)))))))))).)))))).)))))).))....).))))................(((....)))..((((((.(((.......((......))))).))).))).....)))))).)))...))))))))))......)))).).)))))))).)).))))))))...))))..))).))))).)).))))).(((((.((((..(((((....))))))))).)))))..........((((.((((((((((((((((((((((((.(((...(((((((((..((((((..((((((..((((.((((((((.((.((....)).)).)))))....)))))))..))))))..)).)))).(((((........))))).........((((.(((.(((((...(((((.(.((......))).))))).))))).)))))))........((((((.........)))))).)))))))))))).))))))..))))))((((......))))(((.((.......((((((....)))))))).))))))))))).)))).)).))))).))).)))))))...............((((((((((((.(((....((((....)))).......(((.(((.....)))...)))........(((((....)))))..........((((.(..(((.....)))..))))).(((((((((((((((..((((((......))))))..))..............))))))))))).)).((((((.......))))))........(((((((......(((.....)))(((((...)))))...)))))))(((((((((((((.(.((((((.(((((.(((.(((.(((((.(((((.(.((.......)).).)))))..)))...)))))))).))))).)))))).)))))))))).))))...(((((((........)))))))...))))).)).))))))))(((((........((((.(((.......))).)))).....))))).)))))).))...)))))).)).)))))...)))))((((.((((((((((((((..............(((..(((....)))..)))..(((((.....)))))((((((..((..(((....)))..))(((.((((((((.......((((....))))......)).)))))))))..((((...))))........((.(((.((((..((......))...)))).)))))))))))...........))))).).)))))))).)))).((((.(.((((((((.(.((((.(.(((((((((((((...))).(((((.....))))).))))).))))).)))))..........((.((((((.((((((.((((((...((((((((((..(((..(((((((((((((((((........)))..((((((((......))....))))))..........(((((....((((((........)))))).(((((...)))))(((((..........))))))))))....)).))))))).))))).........(.((..(((((((((.......(((((((...((((((((..(((((..(((((((((.((((((((((((((.........)))).)))))).((((((......)))))))))))))))...((((((((.......(((((((.....)))))))....)))))))).(((...((((.((...(((.(.......).))).)))))).)))...............)))))))))........))))))))...))))))).(((((((.....))))))).......)))))))))..)).).(((.((...........))..))).)))..)))))))))))))).))...........)))))).))))))))(((((((((.(..(((((((.((((((((...........))))))))..)).)))))..)))))))))).......................).)))))))).))))).....))))))...)))))))((((((....)))))))))))))...))).))..
Thermodynamic Ensemble Prediction
{{.(({,,,((((..........)))).(((((((,(((((((.((((({.(((((.(,{(((..((..((((((((((,,((({(.((((((..(((((....)))))..)))))).})))),.))))((.((((((.((((((((((.(((.(((((((.(((((..{((((((,{.((,{((((({(,(((.(...((((.(.(,{((.,....((((((....)))))).(((((((((((.(((.((((.((.(((((..((.((((((((({,({((((((...{......,..))))))...((((,.((({{,,(((((((((((((......((.((((.((..((((((({((((((.((.{{((((...))))).)))))))).,....}},,))))..)))))).)).)))))))........,(((((|,....|((((((....((.(((..(({..,((((((..((((...))))))))))....).))..)))...))....)))))}......,).))))))}}}}}.}}))))))((((((((((,({....,.},.....,|,.....,||.|,.}))))))))).}})))).)))))).))....).)))),,..,,..,....{{{((.....|||{{(((((....,,.}}}}.))}.......))))).,.})),....)))))).)))...))))))))))....,.)))).).)))))))).)).)))))))),},)))),.))).))))).)))))})).(((((.{(((,.(((((....))))))))).)))))..........((((.((((((((((((((((((((((((.(((,..{((((((((..((((({..{{((((,{((((,((,(((((.((.((....)).)).)))))....||||}}}.,)))}||,,}}..))),(((((........))))).,{.{,...((((.(((.(((((...(((((.(,{(......))}.))))).))))).)))))))..}}}},,|||{||..,,,,,..))}))).)))))))))))).))))))..))))))((((......))))(((,({.......((((((....))))))}),))))))))))).)))).)).))))).))).)))))))........{{{,.,.((((((((((((.(((..{(((((.,((((.....,...,{,.{{,...,{||,.{{,{,{,......,(({,....,}}}}..........((((.(..(((.....)))..))))).(((((((((((((((..((((((......))))))..))..............))))))))))).)).((((((.......))))))........(((((((......(((.....)))(((((...))))),..)))))))((((((((((((({(.((((((.(((((.(((.(((.{{(((.(((((.(.((.......)).).)))))..)))...}})))))).))))).)))))).)))))))))).)))),,..|})}}}.,,...)))))}}))),,)))))},).))))))))|||,........|{{{{|{{,..{{{,.....,}}}..,,,})))).)))))).))...)))))).)).))))}...)))))((((.((((((((((((((...........,{,(((.,(((,..,}|}..}},..(((((.....))))){(((({..{{..(((....)))..}}(((.((((((((.......((((....))))......)),,))))))))..((((...))))........((.(((.((((..((......))..,)))).))))))))))}....,,.....))))).)}}))))))).)))).((((.(.((((((((.{.((((.(.(((((((((({({...,}).(((((.....))))).))))).))))).})))).,......,|((.((((({.(((((({({{{((,,.((((((((((..(((..(((((((((((((((((........)))..(((((((,.,....))...,)))))).......,..(((((..,.((((((........)))))),(((((...))))){{(((,,.{....}.))))))))))..,})).))))))).))))).........{.((..(((((((((.......(((((((...((((((((.,(((((,{(((({(((,((((..(((({(({(..,......)))).)))))}.,||||,}},...}}}}}|||{|,,|,.,,.{(((((((.......(((((((.....)))))))....)))))))}.,{{.,.((((.((...(((.{.......}.))).)))))),)))...,,..........})))))))}.....,..))))))))...))))))).(((((((.....))))))).......)))))))))..)).}.},.,{{........,..,,..,)}.)))..))))))))))}}}}.))}}......}}.)))))).))))))))(((((((((.(..((((({(.((((((((...........))))))))..)}.)))))..)))))))))).....,,,.,,,....,,.})).}.)))))))).))))).....})))))...)))))))|(((((....)))))})))))))...))).))..

Transcripts

ID Sequence Length GC content
GCCGCCGCCGCCCUUCGCGCCCUGGGCCAUCUCCCUCCCACCUCCCUCC… 2780 nt 0.6360
Summary

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGFB family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. This gene is frequently upregulated in tumor cells, and mutations in this gene result in Camurati-Engelmann disease. [provided by RefSeq, Aug 2016]

Forensic Context

A study in human cadavers demonstrated that mRNA expression of the TGFB1 was significantly higher in the interventricular septum in cases of sudden cardiac death (SCD) without confirmed acute myocardial infarction (AMI) compared to those with AMI, likely reflecting a short duration of ischemia [González-Herrera et al. DOI:10.1016/j.forsciint.2019.109876]. In a rat model of right ventricular failure, the TGFB1 was upregulated (1.2-fold) in the right ventricle, contributing to a transcriptomic signature characterized by fibrosis [Potus et al. DOI:10.3390/ijms19092730]. A study in rats demonstrated that the TGFB1 (Tgfb1) was identified as a potential regulator of methamphetamine reward and addiction via transcriptome profiling of whisker follicles, showing an up-down regulation pattern with expression at 1.75 after self-administration and 0.34 after withdrawal, and it was prioritized through network topological analysis with a betweenness centrality score of 0.0313 [Song et al. DOI:10.1038/s41598-018-29772-1].