Basic Information

Symbol
TGFB2
RNA class
mRNA
Alias
Transforming Growth Factor Beta 2 Glioblastoma-Derived T-Cell Suppressor Factor Transforming Growth Factor Beta-2 Proprotein Prepro-Transforming Growth Factor Beta-2 Cetermin G-TSF Transforming Growth Factor, Beta 2 BSC-1 Cell Growth Inhibitor TGF-Beta2 Polyergin CAEND2 LDS4
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_003238.6
Sequence length
5868.0 nt
GC content
0.4219

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1621.90 kcal/mol
Thermodynamic ensemble
Free energy: -1742.90 kcal/mol
Frequency: 0.0000
Diversity: 1692.76
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((..(((.(((.(((((.((..((((((....)))))..........((((((((((((((((......(((..((((((.(...((((((((((((..(((...((...(((....)))(((((((((((..(((((((((((.(((((....((((..((.((((((.(((.((......((......(((((.((((.((((((..((((..((((((((..((((((.(((...((((((((((....))).....)))))))((((.((..(((..(((((((((...(((((....)))))...((((.((..((.((.(((...))))).))..))))))...........)))))))))..)))))))))..(((((((.(((((((......((((((((......((((((.(((((((...(((.(((((((.(((((((.((((((.(((..((((((((.((((.(((((((.(((((((((((...((........))(((((((((.((..(((((..(((((..((((((........))))))...))).))..)))))..)))).((((...))))........)))))))....)))))))..)))))))).(((.((.(....).)).))).((((........))))..))).))))..(((.(((((((((......))))))))))))..............................((((((......)))))))))))))).))).(((((.......))))))))))).)))))))....((((((..((......))...))))))..............))))))))))))))))))).))))......)))))(((((...)))))....)))......))).)))).).))))))..)))))))))..))))))))..))))))))).).))))...))))).....)).....)).))).)))))).))..)))).))))))))))))))))....))).)))).))))....))..))).)))))))))))).).))))).)..)))......)))))))))).............)))))))..)).)))))..).)).))).)))))))...(((((((((...((((.((((((((((...))))))......(((((((.(((((.(((..(((.((((...((.((((((..(((((((......................((((((..(((((((....(((((........)))))....)))).)))..))))))......)))))))..))))))))........................((((....))))(((((((((...(((((((........))))).))..)))))))))..((((.(((((........((.((((((....)))))))).....((((((...))))))))))).))))..(((((........))))).))))))).))))))))))))))).....(((.(((((((...(((((((.....))))).........)).))))))).)))..((((((((((.((((.....)))))))))..((((((.(((((.((((((.(((((((((((((.....)))....(((((((((((((.((.((((..(((((((.....(((((((((((((((((..((((((((((.....(((((((((((((((((((.(.((((((.(((((((.(((((((.....(((((((......((((((.((((((.((((...........)))).)))).))))))))...((((((((............))).)))))..((((.....))))..........(((((((.(((((((.(((((((((....(((((............)))))..))))...)))))..))))))).)))..)))))))))))......(((....)))(((((((..(((((((((....(.(((((((((((((((((..........................)))))))))...........((((...)))).(((((((.(((.....))))).))))).(((((.........)))))....(((....))).........(((((.....)))))......((((..((((..((..((((.......(((.(((......))))))...((((.....(((((((((((.(((((.(((......)))......((((.(....).))))(((..(((((((((....((((((....)))))))))))))))..)))........((((...)))).............))))))))))))))))))))......))))..))))))...)))))))))))).).))))))))).........))))))).)))))))...))))))))))))).)))))((((....((((..............)))).....))))...........)))))))))))..))))..(((.(((((...(((((((..((....((((.....))))....)).))))))).......))))).))).......(((((.((((.........(((((((((((...(((((((((((..((((((....)))).)).)))))......))))))....((((((((((((.....((((((((..((((...(((((((((((......(((.((.(((.........)))))..)))....(((.(.((((((.(((...))).))))))))))..........(((((((((...))))))))).(((((((...........))))))).....(((........)))..............))))))))))))))).)))..))))).....))))...))))))))........((((((......(((((((..((((((...))))))((........))(((((.......)))))...(((((((...(((((((((((....)))))))))))...))))))).....))))))).....)))))).....((((((((((....(((.((((....(....)..))))..)))(((((((((((((.....((.(((........((((((((...((((.......))))...........)))))))).......)))))...(((((((.(((((.........((((((((....((((.((...)).)))).....(((((((...(((((..((((((((((.(((((((((((((.(((.(.......).))).))))))))).............)))).))))).)))))...)))))(((..(((((((..((((((((....)))))))).)))))))...)))...))))))).......(((....)))((((((...((((((((((((((((((((((.(((((........))))))))))))))))).)))...)))))))))))))..((((((((((..((((((.....))))))...............((((((((........)).))))))....(((.((((.((((.....))))...)))).)))((((((((.....))).)))))(((((((((((..((((.........(((((.(((.((((...((........))...))))))))))))))))..)))).)))))))...((((.......(((...................))).......))))..)))))...)))))....)))))))).........)))))...)))))))...((((((((((...)))))))))))))))))))))))..))))))))))....))))))))))).........))))..)))))............((((((((((((((((.....((((((.((.(((....((((((((((((....)))))).((((((((....((((..(((((((((((((........))))))).((((....)))).....)))))).))))...))))))))....((((.((((....))))..)))).)))))).((((((......))))))..(((((((.......(((((.((((((.(((((((((..((......))..))))))))).(((((((((..(((..((((((((((((....)))))))..((((..(((.((((((.....))))))...)))..))))(((((((((((....)))..)))))))).)))))....(((((((.(((......))).)))))))............(((((((((.......))))))...........))).......((((((((((((.((((.((((((((((.....(((..(((.(((...(((.((((.(((((((.(..((((...))))..).)))))))...)))))))...))).)))..)))))))......)))))).))))(((((((((((((((.(((((...............)))))..)))))))..)))))).))..(((((....)))))((((((((.((..(((((.(((((..(((((((((((....))))((((((.((((..(((((.(((((((........))))..))).)))).)..)))).))))))))))))).))))).)))))....)).)))))))))))))...)))))))))).))))))))).(((((((((((.((........)).))))))))))))))))).))))))).)))))...((((((((........)))))))).))))).))))))))))))))))))))))...)))).)))))))))).....((((((((..((((...)))).)))))))).)))))).))))))).)).))))).)))).))..((.(((......)))))........(((((((((...(((((....(((((((((....)))))))))....((((((((((((.....)))))))))))).............)))))...))))))))).))))))))))))).)))))))))).((((((...........(((((((((((.(((........)))))).......))))))))((((((.......))).))).......((((.(((......)))..)))).)))))).....)).))))))))))))))))))))...)))).))))...)))))))))..((((....))))...((((((((((((((((.....)))))...........)).)))...((((((((..(((((((((((....((((((((((((((((.(((.((((.....((((..(((((((((..........(((((.((..((((((.(((((..(((((((..(((((................))))))))))))..)..)))).))))))...))..)))))..........)))).)))))))))(((.(((((((.......(((((.....))))).((((((.(((((((((((..(((.....((((.((.......)).))))...)))..)).)))))).....))).))))))..............)))))))))).......)))).)))...))))))).))))))))).....)))))))))))...)))))))).........))))))..
Thermodynamic Ensemble Prediction
{{,((({((((((...}))))}.,(((((,,.|})))|||(({.....))))}}{{{{..(((((((((((({((((((((.((({(,,,((((..(((((((((((((.,,.,.({(.,.{|,}((((((((,{{..(((((((((((.(((((....((((..((.((((((.(((.((......((,.....(((({.((((.((((((,.{(((..((((((((..((((((.(((...((((((((({..,.},)...}})))))))((({,{,..{((..{{{(((({{..,{,,{(.,,{|||||{...(((,(((.(({(,{{({{,{||}||{|}.,|||}||..{{,......})))}}))}..))))}}))),.|||||{|}{|||{||,,,{.{((((({({......((((((.(((((((...(((.(((((({.{((((((.((((((.,,,.,{,{({((({((((,{((((((,((.(((((,,({..((((((({..{,(((((((({.{{..{{(((..,.,||..((((((,.,,..{{||||}}..}))),}..,)},}|{{||,,.||||,..},||.,|.,|||}||}||}.,,|},|}|,},}}))},,}))|||},|,|}.,,}.},.})).|})))}})),,})))).,)),))))}..{{{((((((((((......))))))))))||....}}.......................{((((((......)))))))))))))),)))){{{||,.,,.},})))))))))).))))))}....{(((((.,((......}),.,)))))),,............,)))))))))))))))))),}))).,,},,))}}}(((({...)))))}},})))}...,,)))},})),)},)))))..)))))))))..))))))))..))))))))).).))))...})))).,,,.},.....)).))).)))))).))..)))).))))))))))))))))....}},.)))).))))....)),.)))))))))))))))).{,{|}||,((({{{{{{({{.....}}})||||.(((((....{,{{(({,..,.,(((((({({{.,.........(((((....}))))..,{{,{(((((((({....}}}}........(((((({.({({(((({,,({(,((,(,,,,{.((((((..(((((((.......(((({......,,,,{{.......{{{{{.{{{{...|,........,,)))}.)))))).,,..,})))),......)))))))..)))))),},{{{{,...........}}))},.((((....))))(((((((((...{,((({(,.......))))).}}..)))))))))..((((.{{{{{,|....,,,{.,,||||..}}})})))),},...((((({...))))))))))),)))}..(((((........))))}.,||||}}.}}}}}))))}}}}))..,..(((.(((((((...(({({((.....)}))}.........)).))))))).))).}))}}}||||{,|{{|,,,,,)))}})))))),}}.}})))})))||,{{..(((((((((((((.....)))....(((((((((((((.((,((((..(((((((.....(((((((((((((.((,..((((((((((.,.{({{{{{({{{.{{{{|||,|,|,{{|||||{{{{|||..,{{|||||..,||{|||{{{{{{{({{{{(,{{({{{.{,{{(((((((.({{|..((((((((.((((((.,,(({{((((({.,....{{,{||||.||||..((((.....)))).......,{,{,({(((.(((((({.{(((({....,,,|,,{{.{{{((.{{...,,)),}}))),.}}))}))..))))))}.})).,||)),,,.}},....,..,}},.,.))||||||...|||}}}}}}..,,))||,((((((.((((({{..{{({.....{{{{(((((((.........{{{,....}}}....((({...}})).(((((({.(((.....)))},.})))).(((({,........,||,,..,{((|..{{|||.....,,,,(((((.....}}}}}.,,}}}}}},..||||.||,...|||},..}}}|{(.(((......)))}},..||{||,{((((((((((((((((({((,,...((((((((....,.((((.{....}.)))){{{..(((((((((....((((((....)))))))))))))))..|||......,.((((...)))).,...,}}.....,,}},)))))))),)}))|||{{{{{{((((((((..{(((.((...)).)))).)))))))}.,..,,..),,}}}))))}))))))}..))))))}|{{||||{,,.||{{((((.{((((...})))}...............{((({........{((((((..{{{(...{{......)}}}))..))))))),.......)))}}...}))))),...)))))))).......,,,,,..))))))).}}}}..,)})},,.,.,,,,.,{,{{,,|{|||,..||||,,{(({(..{,{{((....)))),)}.}))))......}},}}}})))))))))}...)))))).))))))))...|}}).)))))}}.{{{,,.....|||,,|,|||........,}}}},,,}}},,.,|{{.|.{(((((.(((...))).))))))}})}..,}|,,},.|||||||{(,{{||||||||.,((((.,,,{({{..{(((((((({...{({((,{{...,.(({{{.....{,{(,{{,{{,,,(((((((((((.....(((({{{(.{((.{,,.{...,,....,,,...))),}))))))))))))))))|(((((...)))))|{(....,...},..((((((((...,,,....(((((((.,.(((((((((((....))))))))))).,.))))))){{((((({....{{,,,.(((((...((((((((((((....(((.((((....,....,..))))..)))(((((((((((((..,..({((({...,,,,,(({(((((.,,((((.......)))).,,,,{|.|||||}}}}}}......,|||},...,{({{((,(((((.,....,,.(({{{{{{,...((((.((...)).})))...,.(((((((...{((((,,((((((((({.(,(((((((((({.(((.(.......).))).})))))))))}..,.........,}}.})))),,))))...))))},{{..(((((((..((((((((....)))))))).)))))))...}}}...))))))).......(((....}))((((((...((((((((((((((((((((((.(((((........))))))))))))))))).)))...)))))))))))))..{({,{{{{{,..((((((.....))))))...............{((({{,,,{{...,,))}}|||||{{{,....||||.||||....,}}},...)))},}},((((((((.....))).))))),,,,,|},|||{|}|},...,,},,.|||||,,,,.||||},}||},,...,,))}..))}},,,}}}}}.,}||}}..,,})}}}}},.,((({..,,,,|(|{..........,,...,},,))|.......}}))..}|||||....}|,....,})))))),,},.....))))}...})}}}}|.,,(((((({(({...}})))))))))))))))))))))..))))))))).)))....))))).,,.....||,|},,.,,|,||{{{{.....,,,))))}|||{,{{{{{{{{{,|,.,,,,,,||||{{,,,{{{,,{{((((((....))))))}.|{((({{{{,((({{........|||||{|}},,,,}.||||}|}.{{{,,,|,||}}}}},}}}}|},.,,}}}},,,,|||||,,..((((.((((....))))..)))}..||,,,,||||||,....})))))}.,,||||}}}}}....,||||}|||{({,(((((((((..,,...,,.,),,)))))))},.{(((((({{{{{,,..(((({(((((((....)))))))..((((..(((.((((((,...,))))))...)))..)))){((((((((((....)))..}))))))).))))).....,,,)))),))))))))))))))))(((((({.(((((((((.((((((.......))))))...........,.........((((((((((((.((((.((((((,{{(,....(((..(({,((,.,.((,.((((.(((((((.{..(((,...,}))..}.)))))))...)))),)),,.)}),)))..)))}}}),,....)))))).))))(((((((((((((((.(((((.{.........,.}.)))))..)))))))..)))))).))..{{{{{....}}}}}((((((((.{{..(((((.(((((..(((((((((((....)))){(((((.((((.,{((((.{({((((........)))).,})).}))).)..)))).))))))))))))).))))).)))))....,,.))))))))))))),..)))))))}.........}))))))))}))))))...}))))))))....,,))))),))},,))))),})))))))))}.{{{{{{{{........)))))))}.})))},,,,))))))))))))))))}}..,,))))}})))))}))}......{((((((..((({...}))).)))))))),)))))).))))))).))},)))).)))),||..,,.{||....,,)),,}........(((((((((...(((((.,,,({{{,{{{||,..,||||||,,...,{(((((((((((.....)))))))))))),,}}},}},.,..)))))...))))))))).))))))))))))).)))))))))).||{||........,,,|{{|||||{|||.||{..,,,,,,)}}}))}..,..,|||||}|}{{.........,,},)}))}}........))))))))},,{(((((.((......)).))))))...}}..))))).))))))),,,.,|||.,{,|,{{||..|||||..||||}}..,|||{,.(,{,,.,,,..(((((.....)))))........,.,))))),...((((((((.,(((((((((((....((((((((((((((((...,,(((,.....((((..{{{{{{{((,,,,......(((((,{,..{{||||,{(((..{((((((|.,{((((.....({,..,,,,..))))))))}}},,}..,||||,|}}}}}...}}..))))}..........}))).)))))))))((,{(((((((.......(((((.....))))).((((((.(((((((((((..(((.....((((.{{.......)).))))...)))..)).)))))).....))).))))))..............)))))))))).......}))}.))}.,.)))))))})}))))))).....)))))))))))...)))))))).,,.....}))))))..

Transcripts

ID Sequence Length GC content
GAUGUUAUCUGCUGGCAGCAGAAGGUUCGCUCCGAGCGGAGCUCCAGAA… 5952 nt 0.4242
GAUGUUAUCUGCUGGCAGCAGAAGGUUCGCUCCGAGCGGAGCUCCAGAA… 5868 nt 0.4219
Summary

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers. A chromosomal translocation that includes this gene is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. Mutations in this gene may be associated with Loeys-Dietz syndrome. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]

Forensic Context

A study in humans and mice demonstrated that the TGFB2 is a target gene of the transcriptional regulator JDP2 within the cardiomyocyte enhancer gene-regulatory network specific to the vCM3 stressed cardiomyocyte state following myocardial infarction [Kuppe et al. DOI:10.1038/s41586-022-05060-x].