| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUGUUAUCUGCUGGCAGCAGAAGGUUCGCUCCGAGCGGAGCUCCAGAA… | 5952 nt | 0.4242 | |
| GAUGUUAUCUGCUGGCAGCAGAAGGUUCGCUCCGAGCGGAGCUCCAGAA… | 5868 nt | 0.4219 |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers. A chromosomal translocation that includes this gene is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. Mutations in this gene may be associated with Loeys-Dietz syndrome. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
A study in humans and mice demonstrated that the TGFB2 is a target gene of the transcriptional regulator JDP2 within the cardiomyocyte enhancer gene-regulatory network specific to the vCM3 stressed cardiomyocyte state following myocardial infarction [Kuppe et al. DOI:10.1038/s41586-022-05060-x].