Basic Information

Symbol
TGFBI
RNA class
mRNA
Alias
Transforming Growth Factor Beta Induced BIGH3 CDGG1 CDB1 Transforming Growth Factor-Beta-Induced Protein Ig-H3 Transforming Growth Factor, Beta-Induced, 68kD RGD-Containing Collagen-Associated Protein Kerato-Epithelin Beta Ig-H3 RGD-CAP CSD1 CSD2 CSD3 LCD1 Transforming Growth Factor, Beta-Induced, 68kDa Transforming Growth Factor Beta-Induced 68kDa Betaig-H3 CDG2 EBMD CSD
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000358.3
Sequence length
2712.0 nt
GC content
0.5306

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-949.80 kcal/mol
Thermodynamic ensemble
Free energy: -994.14 kcal/mol
Frequency: 0.0000
Diversity: 816.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((((..((.((((((((.((.((((...((((((((((.(((.(.(((((((........))))))).).))).))))..))))))....((((((((((((......((((((((.(((((..((((((...)))))).))))).....((((....))))..((((((((.((.(.(((((((......)))))))...).)).)))))))).((.((((.(((((((..((((.....(((((((((.(((....))))))).....((((.....(((((....(((.(((((.((((((.(..(.(.(((((.(((((((..(((((((((((((((((((.((((((((((((((......(((((((((((.....((((..(((((((..(((.....))).((((((((((..........(((.((((..(((.(((((((((((((.(((((......))))).))))))).((.....))....)))))).))))))).))))))))).))))...))))))).))))..(((((....))))).((((.....(((((.(((........))).)))))((.(((.(((...(((((((.((......((((((....((((((..((((............))))..)).......((.(((((...))))).))....))))..))))))(((((......)))))((((((.((.......)).)))))).)).)))))))...))).).)).))..................)))).((((.....)))))))).....)))))))......))))))))).))).(((((..(......)..))))).....(((...((((((.........))))))...)))....)).))))).......))))))).).))))))....))))))).))))).))..).)))..)))..)).))).)))....))))))))))))))...))))..))))))))))).))...)))))))).....))))).))....))))).))))...)))))))))).))..)))))(((.((.((((((.......((((((((..(((((......(((((((....((((.....))))............((((((...)))))).(((((((((((((..((.....))..))))))...)))))))((((((((..(((......(((((((((...((((((....(((((((..(((.((...)).))).))))).))...))))))...)))))....((((.(((...((((.....)))).)))))))......)))).....)))..)))..))))).......((.((((((..(((..((...((((((.(((((((.......((((((((.((..........)).))))))))))))))).)).))))...)).....)))..))))))..))(((((((.((......(((((.(((.(((.((((.(((((...))))).)))).)))))))))))..))))).))))...)))))))......)))))..)))))))).(((.(((((..........))))).)))(((((((....((((((((......).))).))))...))))))).....(((.....(((((((.((((((((((.......(((((((((((((((((.(((..(((((((((((...........))))........(((((((((((((.......((((((...((((.((((..(((.((..(((......(((.(((..((..(((((((.....)))))))....))....))).))).))).)).)))..)))).))))..).)))))..(((((((((.......)))).))))))))))))))))))........(((((((....(((.((((((....((((..((......))..))))...)))))).)))........(((..(((.....(((((((((((((((((.(((.((.....)).(((.((((...........)))).))).(.((((....)))).).........(((((..(((......)))..))))).......(((((..(.....)..))))).((((((((((((((......((((..((((((((........((((......))))...))).)))))..))))(((((((((((((((.(((((...(((...........)))...)))))))).((((....))))..))).)))))))))......(((((((((.....))))))))).((((((...((((......((...((((......))))...))....))))))))))...((((((((......))))))))..)))))))...)))))))...))))))).)))))))))))))....)))..)))...((....))...)))))))...)))))))........))).)))))....))))))))........)))).......)).).))))))))))))))..)))(((.(((((..(((((....((((((((.......)))...))))).)))))..))))).))))))))).)).))).......................
Thermodynamic Ensemble Prediction
......{({{((,.((.({{{|{{{,(,,(((({{{(((((({(((.(((.(.(((((((........))))))).).))).))))..)))))).,,,(((,,((((,((((...{(({((((({(,,,,..||||||}.}))))))})))||{{.,{(({,,{{{||||,.((((((((.((.(.(((((((......)))))))...).)).)))))))).({.(({(,(((((((..{(((,,,(,(((({(((,{(((....)))))))......||......{((((,...({{.{{{{{.{{{|||.|,,|}|}|{|||,|{{{{{(.,((((({{{{(((({({((({(((({{{|||||||,....,||{{{,||||},....((((..(((((((,.{((.....}||.((((((((((..........(((.((((..(((.(((((((((((((.(((((......))))).))))))).||.....|}....)))))).))))))).))))))))),,))).}}))))))).))))..(((((....))))),}.}|},}}}||{||,{{|,.,,,,..)))})))),})}|||.{{{||}|||||,||{{..,,,{({((((.,..{{{{{{{{{(((,,,{....,,...,,,.,||.,,,,..{{.{((({...))))).)}...,}|}}.,}||{,,(((((......))))).,|||{,{|,.......|{||||||{.{{||,,,,....)))}},}}.}),}}.,,.,,.........|,||,({{{,,,,.)}}}||||.,.,|}))))|}.,,...)))}}}}}},}}|,((((({{(,,{{..,.,|||||||...(((...((((((.........})))))...}}}..,.||{}}|||,.,....}}}}}}|.|.}}}}}}....}))}))),)))}).},},}.}}}.|}}}..}},|}},)}}....}}}}}}}}}))))||,,|}}}..}})))))}))).)),,,))))|))){{{{.,,,))})},||||||||.}}}},,,||||||}}}|,||..|}}}}|{{,(({{,{{,,....{{{((((((((..(((((......(((((((,,{{(,((,..{{|||}..{{..,.,,..((((((...)))))).(((((((((((((..((.....))..))))))}..)))))))((((((((..(({......{{{,{((((...((((((....(((((((..({(.{|...}).))).))))).))...))))))...))))|.,,,(((({(({.,.((((.....)))).))}}}},..}}}}}})),,...)))..)))..))))}.......{,.({((({..{{{..|{{,.{{{{{{.{{{((({,,,,,,,{(((((((.((..........)).)))))))))}}}}}}.}},,}}}...,}}}...)))..)))))),.,.|||||{{.|,......(((((.(((.(((.((((.(((({...})))).)))).)))))))))))..})))).)))}...))))))).,....)))))..)))))))).||{.|||{{,,,,,,,,.,))))).}||(((((((....((((((((......),})).)))).,.))))))}.||.{{{,.....{(((((||(((((((|||...,,,,||{.,({{{{{{{{|||,|{{|.(((((({{(((...{,......)))},.......(((((((((((({.......((((({...((((.{{{(||(({.{{,.(((....,,({(,{((..{(..(((((((,...,)))))))....})....})).)))}))).}).})).,)))).))))..}}}))))..(((((((((.......)))).)))))))))))))))))).,.,,,,.(((((((....{{{,(((,{{...}|||{..{(......}|,.|}}},,,||||}}.}}}.....,,,||,.,|||||...(((((((((((((((((.(((,((.....}}.(((.((((...........)))).))).,.{{{{....||||{|.,{......(((((..(((......)))..))))).......{((((..{....,,..})))}.{{((((((,,,,||},,,.,{((({.{{,,{,||...{||{{{,(({{{{{{|||,..,},).)))),}}))))|((((((((((((((.(((((.{.(((........,..})).}.)))))))).{{((....}))}..))).))))))))},,....{((((((((.....))))))))}.(((((,,..(({....}}},...,.)))},.,|||,||,..,}|,,,})}}}))),,.,,((((((((......))))))))..,,,,}}),..))))))}...))))))).))))))))))))).,|,|||..|||{{.,,..}}))}..)))))))...})))}}}.,.....,))).)))))....)))))))),..((((({..,,,,,..,}}})}))))))))))))))..}})|||,|||||,,|||||....|,,,||||,}||,,,),.,,,.,,,..))),}},))}}).)}))))}))|}}|},,..........,,,..,,,.....

Transcripts

ID Sequence Length GC content
CUCACUUCCCUGGAGCCGCCCGCUUGCCCGUCGGUCGCUAGCUCGCUCG… 2712 nt 0.5306
Summary

This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the TGFBI gene is increased in monocytes from clodronate-treated, brain-injured animals and is associated with an immunosuppressive, neuroprotective phenotype [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8]. In human postmortem brain tissue from individuals with opioid use disorder, multi-omics analysis identified the TGFBI gene as upregulated and part of dysregulated pro-angiogenic networks, with its protein interacting with COL4A1/COL4A2 in endothelial cell processes [Mendez et al. DOI:10.1038/s41380-021-01259-y].