| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCACUUCCCUGGAGCCGCCCGCUUGCCCGUCGGUCGCUAGCUCGCUCG… | 2712 nt | 0.5306 |
This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the TGFBI gene is increased in monocytes from clodronate-treated, brain-injured animals and is associated with an immunosuppressive, neuroprotective phenotype [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8]. In human postmortem brain tissue from individuals with opioid use disorder, multi-omics analysis identified the TGFBI gene as upregulated and part of dysregulated pro-angiogenic networks, with its protein interacting with COL4A1/COL4A2 in endothelial cell processes [Mendez et al. DOI:10.1038/s41380-021-01259-y].