| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACGGAGCCCGGACCUCCACACUGAGCCAUGCCCACCCCCGACGCCAC… | 1827 nt | 0.6585 | |
| AGACGGAGCCCGGACCUCCACACUGAGCCAUGCCCACCCCCGACGCCAC… | 1920 nt | 0.6609 | |
| AGACGGAGCCCGGACCUCCACACUGAGCCAUGCCCACCCCCGACGCCAC… | 1908 nt | 0.6614 |
The protein encoded by this gene is involved in the conversion of tyrosine to dopamine. It is the rate-limiting enzyme in the synthesis of catecholamines, hence plays a key role in the physiology of adrenergic neurons. Mutations in this gene have been associated with autosomal recessive Segawa syndrome. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the TH mRNA expression in adrenal glands increased near-stepwise with the intensity of contusion stress (p < 0.0005) and showed a pronounced time-dependent decrease with increasing postmortem intervals, particularly in the stressed group (p < 0.0001) [Takahashi DOI:10.1620/tjem.216.239]. In a separate methodological study in mice, the TH protein was used as an antibody target for rapid immunolabeling to successfully isolate dopaminergic neurons via laser-capture microdissection, with subsequent qRT-PCR confirming the expression of the TH gene in the captured cells [Chabrat et al. DOI:10.3791/52510]. A study in rats demonstrated that the TH mRNA expression in adrenal glands increased near-stepwise with the intensity of contusion stress (p < 0.0005) and decreased significantly with increasing postmortem interval, indicating its efficacy as a marker for acute sympathoadrenal response during the early postmortem period [Takahashi; Shirushi DOI:10.1620/tjem.216.239]. In mice selectively bred for methamphetamine consumption risk, the TH gene was profiled as highly expressed in the ventral midbrain, with its expression pattern analyzed as part of transcriptomic networks associated with addiction risk in the absence of drug exposure [Hitzemann et al. DOI:10.3390/brainsci9070155].