| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGUCAGAGGCUGCCUCGCAGGGGCUGCGCGCAGCGGCAAGAAGUGUCU… | 4040 nt | 0.5468 |
The protein encoded by this intronless gene is an endothelial-specific type I membrane receptor that binds thrombin. This binding results in the activation of protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated. Mutations in this gene are a cause of thromboembolic disease, also known as inherited thrombophilia. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that post-mortem thrombomodulin (TM) levels serve as a biomarker for lethal hypothermia, with significantly lower TM mRNA and protein levels in the myocardium and lower TM concentrations in urine in hypothermia deaths compared to controls from cardiovascular disease, trauma, or other causes [Pakanen et al. DOI:10.1007/S00414-014-1138-2].