| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCGCUGCGCCCGAGCUGGCCUGCGAGUUCAGGGCUCCUGUCGCUCUC… | 7789 nt | 0.4571 |
The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the THBS1 was upregulated in circulating leukocytes from patients with burn sizes greater than 40% total body surface area, showing a fold change of 2.21 [Sood et al. DOI:10.0000000000000905]. In a separate human myocardial infarction study, the THBS1 was identified as a direct target gene of the transcription factor TEAD3 within the fibroblast enhancer-gene regulatory network, specifically in the context of myofibroblast differentiation and cardiac remodelling [Kuppe et al. DOI:10.1038/s41586-022-05060-x]. A study in humans identified thrombospondin 1 (THBS1) as part of a six-protein panel with predictive value for sudden cardiac death risk in patients with hypertrophic cardiomyopathy, demonstrating high diagnostic accuracy using UPLC-MS/MS [Raluca-Maria Cătinas et al. DOI:10.3390/ijms26146818]. In a rat model of spinal cord injury, the gene encoding thrombospondin 1 (*Thbs1*) showed a specific temporal expression pattern, being up-regulated in the rostral spinal cord segment during early post-injury phases (1 and 8 days) and down-regulated at 45 days post-lesion, while it decreased in the caudal segment [Bighinati et al. DOI:10.3390/ijms22041744].