Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUGUGUCAGAGGAAGCAACCAUGCAGGUGCUAACCAAGCGUUACCCCA… | 1174 nt | 0.5060 |
Summary
The protein encoded by this gene is similar to the gene product of S14, a rat gene whose expression is limited to liver and adipose tissue and is controlled by nutritional and hormonal factors. This gene has been shown to be expressed in liver and adipocytes, particularly in lipomatous modules. It is also found to be expressed in lipogenic breast cancers, which suggests a role in controlling tumor lipid metabolism. [provided by RefSeq, Jul 2008]
Forensic Context
A study in humans demonstrated that the THRSP was upregulated in skeletal muscle of heavier co-twins within BMI-discordant monozygotic twin pairs, where it was linked to lipid metabolism [van der Kolk et al. DOI:10.1016/j.xcrm.2021.100226].