| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUGCGAGGAAUGGCAGCGGCAGCAGCAUCCCCGCCAGAGGCGGCGG… | 10655 nt | 0.4249 |
The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
A study in human heart tissue from sudden unexplained death (SUD) cases demonstrated that the THSD7A was significantly upregulated in the "primary normal" SUD subgroup compared to heart-healthy controls, where it is involved in angiogenesis [Neubauer et al. DOI:10.1007/S00414-025-03414-4]. This differential expression was identified through whole transcriptome sequencing and DESeq2 analysis, contributing to the unique gene expression pattern observed in that specific pathological subgroup.