| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCAUCGCCGCAGAUCCAGCGCCCAGAGAGACACCAGAGAACCCACCAU… | 769 nt | 0.5748 |
This gene belongs to the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. In addition to its inhibitory role against most of the known MMPs, the encoded protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. [provided by RefSeq, Jul 2008] CIViC Summary for TIMP1 Gene
A study in rats demonstrated that the TIMP1 gene was strongly up-regulated at 1 day post-lesion in spinal cord segments rostral and caudal to a contusion injury, with expression progressively declining but remaining slightly up-regulated at 45 days, and bioinformatic analysis identified it as a hub gene involved in ECM remodeling, which was validated at the protein level in tissue and in primary mouse astrocyte cultures exposed to cytokines [Bighinati et al. DOI:10.3390/ijms22041744]. In a separate investigation of sepsis-induced myocardial dysfunction using cross-species bioinformatics and validation in mouse models and human data, the TIMP1 was identified as a novel disease gene, showing significant up-regulation and was recognized as a sepsis-associated protein [Yao et al. DOI:10.1016/j.ygeno.2024.110911]. A study in mice demonstrated that the TIMP1 was not altered by a cortical cryolesion or by the absence of tumor necrosis factor receptor 1 (TNFR1) signaling [Quintana et al. DOI:10.1002/jnr.20680].