Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAAACACAUCCGUAGAAGGCAGCGCGGCCGCCGAGAACCGCAGCGCC… | 3652 nt | 0.5370 |
Summary
This gene is a member of the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. In addition to an inhibitory role against metalloproteinases, the encoded protein has a unique role among TIMP family members in its ability to directly suppress the proliferation of endothelial cells. As a result, the encoded protein may be critical to the maintenance of tissue homeostasis by suppressing the proliferation of quiescent tissues in response to angiogenic factors, and by inhibiting protease activity in tissues undergoing remodelling of the extracellular matrix. [provided by RefSeq, Jul 2008]
Forensic Context
A study in humans found no significant difference in the TIMP2 mRNA expression in the eutopic endometrium of women with endometriosis compared to controls, as it was mentioned in the introductory discussion but not experimentally studied in that investigation [Malik et al. DOI:10.1016/S1472-6483(10)60858-9]. In rats exposed to blast wave trauma, mRNA for the TIMP2 was down-regulated after a 5 psi blast but up-regulated at 24 hours after 10-11 psi exposures and at all time points following 14-15 psi exposures, correlating with vascular injury and repair processes [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. A study in rats demonstrated that the TIMP2 mRNA expression in skeletal muscle contusions decreased at 6-24 hours postinjury, peaked sharply at 3 days postinjury with a relative quantity of 2.98, and returned to near normal by 10 days [Yu et al. DOI:10.1111/1556-4029.13001].