Basic Information

Symbol
TIMP3
RNA class
mRNA
Alias
TIMP Metallopeptidase Inhibitor 3 Tissue Inhibitor Of Metalloproteinases 3 Metalloproteinase Inhibitor 3 Protein MIG-5 TIMP-3 SFD Tissue Inhibitor Of Metalloproteinase 3 (Sorsby Fundus Dystrophy, Pseudoinflammatory) MIG-5 Protein HSMRK222 K222TA2 K222
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_000362.5
Sequence length
4597.0 nt
GC content
0.4866

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1545.80 kcal/mol
Thermodynamic ensemble
Free energy: -1633.06 kcal/mol
Frequency: 0.0000
Diversity: 1270.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((((((.(((((((((.(((.....((.((((((((.((((((((((((...((((.((((((((((.((((...((.((((.((((((((((.((..(((((((((...)))))..)))).............)))))).)))))).)))).))...))))...(((((((((((..((.((.((((((((.((((....))))(((((...)))))))))))).).)).))..))))))))))).)))).))))))..((((((....))).)))((((((((((((((..((((((((((((.((((.(((.((..((((((..((.(((((((((.(((((.((....(((((....))))))))))))...)))))))).).))..))))..))..))))).)))))))))))))))).((((((((((((((.((((..((.((((((((((((.(((((.((((.(........).))))..)).))).)))))).(((.((((...(((((((((((((((......((((((.((((....)))).)))))).((((..(((((.(((........)))...(((((....))))).((((((.((....)))))))).(((((((........)))))))((((((((((.....)))).)))))))))))..)))).(((((....))))).......((((.(((...(((.(((...))).)))))).))))(((((.(((((....(((((((..(((((((...((((((((.((........)).)))))....((((...)))).))).))))).)).((((.....))))(((((.((((....((((.((....((((..((((((....))......((((.....)))).........(((.....))).....))))..)))).............)).)))))))).)))))((.((((((.((....((.....)).....))..))))))))........(((.......))))))))))....))))).)))))...))))).))))))))))...)))))))..........)))))).)).))))..(((((((((((..((.(((((...((((((....))))))...))))).)).))))))))))).((((((......))))))...(((.(((.((.(((.....))).)).))).))).....(((((...........)))))((((..((.......))..))))..))))))))))))))....(((((((..(((.(((((.(((((.(((((((((((...(((((...(((((((((((.........((((((((....)).))))))((((((((...((..(((.((((.(((.(((..(((((((((......)))))))))..))))))...)))).))).)).....))))).))))))))))))))..))))).))).)).))))))...)))))......))))).))))))))))..((((((...(((.(((((.....((..((((.(((((((((..((((((........))))))((.((((.((..(((((((.((.((((((........((((((..(((((.............))))).(((((((....(((((.(((......)))..)))))(((((((..........))))))).......)))))))))))))..((((....))))...)))))).))..))))))).)).)))).))..(((((((((.(((((..................)))))(((((((((.((...(((...(((((...(((((((((((...))))))))))).))))).)))...)).)))))))))......)))))))))..(((....))))))))))))........)))).)).....))))).)))....))))))..........(((((...........))))))))))))))))))).....((((((((..(((.((........)).))).))))))))(((((((.......))))))).((((......)))).......((((((((((((.(((((....))))).))...(((((((..................((((((((((((((((....((((((((((((((((.(((.(((........))).)))..))).)))))).)))))))((((((((.((((((((((.((.((....)).)).)))))))....((((((((((((((.(((((((......(((((((.(.....).)))).)))...(((((((((.(((((((((.(((((((((...((((((((...(((.(((....))).)))...))).)))))(((((((((.(((((((((((.((((........)))).))))).)))))).))))...)))))........((((((...(.((((((((((........)))))))))).)....))))))....)))))).))))))))))))..))))).))))(((..((((((((.((..........((((((((.((((.(((((((((.((((((.......(((((.((..((((((.((((......))))...))))))......)).)))))))))))...............((((((.(((...)))...))).)))........)))))))))((((...))))(((((..((((((..((((((.(((.(((((((....((((((((...)))..))))).....))).)))))))))))))))))))..))))).....((((((......((((((((.((((((......))))).(((((((.(((.(((((((((((.(((((...((((..((((((((((.(((((((.....).)))))).)))))))).))..))))(((.((((((((...))))))))..)))......................((((((.(((((....))))).)).)))).))))))))))....((((((....)))))))))))).)))))))))).(((.((((((((((((...((.....))....))))).))))))))))..((((((.....((((((((((((.....(((.((((....((....(((((.(((((((.........))))))))))))...)).....))))))).)))))))(((((.....))))).....(((.((((((((.((((((((((((((((...........((((.((((....(((((.((....)).)))))..))))..))))...(((((((((......(((((......(((((.((........)).)))))......)))))..)))))))))......((((.(((((((.(((............))).)))))))(((((......))))).)))).)))).))....)))))).)))).)))))))).))).)))))......)))))).).))))))))..(((((((....)))))))))))))))))..)))))))).........)).)))))))).)))..((((((.(((((((((((((..(((.................(((((..(((.((((......)))).)))...))))).....)))))))))))))..))).))))))...))))))).))(((((((...(((((...(......)...)))))...))))))))))))))))))).)))))))))))(((((((((.((((((((....))))))))...))))))(((((....)))))...))).......((((.(((((((((.......))))....)).))).))))..)))))))))((((......)))).....(((((....))))).......))))))))))))))........(((((((...((((....)))).))))).))....((.(.((((((......)).)))).))).(((..(((((.((((.(((((......)))))...(((((.((((...(((((((((..........))))))))))))).))))).)))).)))))...)))...))))))))))((((.((.......)).))))....))))....))).))))))))).)))))))))).((((((((((((((((((...)))))))))))......))))))).))).))))))..........))).)))))))))))............(((((((((((((((((((((((.((((.((......)).)))(((((((((..((((((........)))))).....))))...)))))..(((((((((((((((.....))).)))))))).))))).))))))................((((......))))....(((((((......)))))))))))))).)))))))))).
Thermodynamic Ensemble Prediction
.....(((((((((((.(((((((((,(((,.,.,((,(((((({(,(((((((((.{(((((((({(((({,,,,,|{{|||,,((,((((,((({(((((({({..(((((({((,.,||}}|{,||||,,...,,,{.,,{||||||,}}}}}}.||||,||..{||}}.}}|{,,{||||||,,{|.,|}|||||||||||.|,,,,|,,||||{|,.,))))}),)))))}),})}))..)))}})))))).||||||,}}|}..{{{{{(,,..))).)))((((((((((((({..((((((((((((.((((.(((.{{..{,((((..((.(((((((((.((((((((....(((((....))))))))))))...)))))))).).))..))))..,...)}))).)))))))))))))))).((((((((((((((.{{{,.,((,((((((((((((.(((((.((((.{........).}))).,}).))).)))))).{((.((((...(((((((((((((((..,{{...,(((,((((.,{.||||,|}||||{((((..,{,{||||||,.,,,|.}}}.{,(((((....))))),{(((({.{{..,,}}}}}))}.{{{((((,{{,{,..}}}|||(((((((((((.....))))))))))))},}}|,}|||{((({{.,,.|||||,{{|.|,((((.(((...(((.(((...))).)))))).)))}{((({.{{{{{,,..{{|||{{..(((((((...((((((((.((........)).))))}....((((...)))),))).))))).)).((((.....)))){{|||,|({{....|||{,||,,,,||{|.|(({,,,,,,,}|......((({.....}))),.|||.,,,)||.|,|,,||...,})},,...,,,.....,,,,...,)},))}))))),))}})((.((((((.{{,{..,{.....}}.....)}..))))))}),{{,,,..{((.......)))}}}))))},..,,}}}.,}))}...))))).))))))))))...))))}}|...,|,|,..)}}))).,}.})))..(((((((((((..((.(((((...((((((....))))))...))))).)).))))))))))).((((((......))))))...{{{.{((.,,.{{{.....||}.,,.})),))}.....{((((...........)))))||||,.,|.......)),,)))),.))))))))))))))....(((((((..(((.((((({(((((.(((((((((((...(((((...(((((((((((.........((((((((....)).))))))(({(((((...((..(((.((((.(((.(((..(((((((((......)))))))))..))))))...)))).))).}}.....))))).})))))))))))))..))))).))).))))))))),,})},))}.....,)))).))))))))))..{(((((...,,,....{({,{.((((((...((((((,(({,.((((((........))))))((.((((.{({.(((((((.(,.((((((.,,,..,{{{((((.,({{{,.....||,|..,||||}|,(((((((...|||||(.(((......}))..)))))||{{({{.,,,,.,,,.}}}}))).,,,,..))))))}}}}))},}|{{(....)))}...)))))).,}..))))))).)).)))).)}..{((((....((((((..................))))))...))))))}))))))...)))))).|,||(((((((((...)))))))))|{{{|||.{{{{,{(({{(((((.(((....}))...)))))}.))).,.})))},..,,}))}},.......{{{{{{.{,,{..,,)))),,..)))))).,,,......,{|||,,,,.......}}}},}))))))))))))),{,,{(({{{{{{.,{{{,|{......,,||,|}}.}}}}}}}}{{(((((.......)))))),...||,....|||}},,.,,...............(((((....))))).||{{{({{{{{{,,,((((((,,...||.{|||(((({(((((({,,{{((,((((((({,,||{|.||{}|||,..,,},,}},.}}),,)))},})))),}))))))|{||||||,{|||||{|||}||.||,..{||,||,|||}},,.|{,((((((((((((((,(((((((......,{{(({{,{..,,.|,|||}.,|{,{,||||(((((.((((((((,{((({{{{{,...{(((((((...(((.(((....))).)))...)))},)))}{{(((((((.(((((((((((.((((........)))).))))).)))))).)))},}}}}}}}...,,,..((((((,..{.((((((((((........)))))))))).},}},)))}}}.,,.}})))).))))))))))))..))))).}}}|,|||,(({(({{{.||,||{{||||.||,,,,,,.(((,.{((({{({{.((((((....,..(((((.((..((((((.((((......))))...))))))......)).))))))))))).,,.........||,{{((((.{{,...}))...)))}}))...,.,,.,,}||||||{{{,,{,,|||(((((..((((((..((((((((((.(((((((.,..((({,(({...)))..,,,}),....))).)))))))))))))))))))..)))))...|||||||||{,...(((((({,.,(((((,.....))))).(((((((.(((.(((((((((((.(((((...((((..{{((((((((.(((((((.....)})))))).)))))))).}}..)))){({.((((((((...))))))))..))}....,........},.......((((((.(((((....))))).)).)))).))))))))))....((((((....)))))))))))).)))))))))).(({,((((((((((((,,,((,,,,,|}...,||}}},|}}}}}}}||{.((((((.....{(((((((((((.....(((.((((....({,({.(((({{(((((((.........)))))))))))).}})).....))))))).)))))))(((((.....)))))...,.(({.((((((((.((((((((((..((((,,,,.......,,,{,||||,|,.(((((.((....)).)))))..}}}}.,|||}...{((((((({......(((((.,.{{{(((((.((........)).))))},}}}..))))),.))))))))}....,,||{{.(((((((,(({...,...,,,,.}}}.))))))){{|||,,,,..}}}||.|}},.,}}},)),...))))))},))).)))))))),})}.)))}}......)))))).,}))|||}||,{(((((((....))))))).,,|{|}}}}}))}....||,....,},.}}.}}}})})).,}},,,|||||}||||||{{(((((,...,.,,....,}}},,....|||||,|{||.((({...,,,||||.}||{..|||||,....,)))))}}|||}},,||||||,||....}}}}))),))(((((((...(((((...{......)...)))))...)))))))}))))))))}))}))))))))}}}||||((({(,{{{||{||....}|||}}||,,.,}}}}|(((((....)))))},,,)}})))...{|||,{{{||||||.,,,,..}}}}.,,,))||||,}}}}..,}}))))),((((......)))).....|||||,,,,}))))....,,,)))}))))||||}.....,,}|||(((((...((((....)))).))))|,||,...,{,{.((((((......)),,)))|{{{{,...}||||{{((({..(|,,,|}..,))))},..|((((.{(((..,(((((((((..........))))))))))))).))))}..,}}..,,},..,))),,,))))))||||,|||||{}}},....,,{{{...,||,|{,..}})))})))}}))),)|||||||,|.(((((({(((((((((({...})))))))))),,,...))))))),})),)))))),..,,,,...))).)))))))))))............(((((((((((((((((((((((.{{((.({......)).))}(((((((((..,(,((({{......,))))),....))))...))))).,((({{((((((({({.....}))|,))))))).)}}}}.)))))).,,,..,|,..,}}}.((((......))))....(((((((......)))))))))))))).)))))))))).

Transcripts

ID Sequence Length GC content
AGAGCGGGCAGCAGGCAGGCGGCGGGCGCUCAGACGGCUUCUCCUCCUC… 4597 nt 0.4866
Summary

This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix (ECM). Expression of this gene is induced in response to mitogenic stimulation and this netrin domain-containing protein is localized to the ECM. Mutations in this gene have been associated with the autosomal dominant disorder Sorsby's fundus dystrophy. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human ex vivo skin explants demonstrated that TIMP3 (TIMP Metallopeptidase Inhibitor 3) mRNA was significantly upregulated in burned tissue at 24 hours post-burn, identifying it as an early burn response gene [Foessl et al. DOI:10.3390/ijms22179209]. A study in rats demonstrated that the TIMP3 mRNA was upregulated at 24 hours after a 10–11 psi blast exposure and at all measured time points following a 14–15 psi blast exposure, correlating with vascular injury and wound healing processes in a model of mild traumatic brain injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].