| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCGGGCAGCAGGCAGGCGGCGGGCGCUCAGACGGCUUCUCCUCCUC… | 4597 nt | 0.4866 |
This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix (ECM). Expression of this gene is induced in response to mitogenic stimulation and this netrin domain-containing protein is localized to the ECM. Mutations in this gene have been associated with the autosomal dominant disorder Sorsby's fundus dystrophy. [provided by RefSeq, Jul 2008]
A study in human ex vivo skin explants demonstrated that TIMP3 (TIMP Metallopeptidase Inhibitor 3) mRNA was significantly upregulated in burned tissue at 24 hours post-burn, identifying it as an early burn response gene [Foessl et al. DOI:10.3390/ijms22179209]. A study in rats demonstrated that the TIMP3 mRNA was upregulated at 24 hours after a 10–11 psi blast exposure and at all measured time points following a 14–15 psi blast exposure, correlating with vascular injury and wound healing processes in a model of mild traumatic brain injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].