Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUCAGGCUGAAGUGUCUUAAUGACUAGAAUUCAGGUUCCAAGGAGAAG… | 1758 nt | 0.4261 |
Summary
This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Forensic Context
A study in mice demonstrated that the TINAG was downregulated 11.245-fold at 12 hours post-injury in incised skeletal muscle wounds [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027]. In a separate study in rats, the TINAG was downregulated at 12 hours but upregulated at 48 hours following mild traumatic brain injury [Colak et al. DOI:10.1016/j.injury.2012.01.021]. A study in mice demonstrated that the TINAG was downregulated 11.245-fold at 12 hours post-injury in skeletal muscle incised wounds, as identified through DNA microarray analysis [Mohammed Hassan Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027].