Basic Information

Symbol
TINAG
RNA class
mRNA
Alias
Tubulointerstitial Nephritis Antigen TIN-AG TIN-Ag
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis

MANE select

Transcript ID
NM_014464.4
Sequence length
1758.0 nt
GC content
0.4261

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-473.50 kcal/mol
Thermodynamic ensemble
Free energy: -504.96 kcal/mol
Frequency: 0.0000
Diversity: 393.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.(((((..(((.....))).....)))))..(((((.....((((.....)))).......)))))......((((.((((((((((.(((.((..((((((...(((((...(((((..(((.........)))..)))))..)))))....)))))).((((..((((((....((((...)))).((((....(((((((((((((((((((((((..(((.........)))....)))))...((((((((((((.((((...((.((.(((((...(((((((((((....)))..........((.((((((.(((((.(((((((((....)))))).........)))))))).)))))).))..(((((((..((((((((...(((..((((((((((..((((.(((..........))).))))...(((((((((...)))..))))))(((((..((((.....)))).)))))((((..((((...........))))....))))..(((((((..(((((..........)))))..))))))).((.((((((((............)))))))).)).)))))).)))).)))..)))))))))))))))))))))))))))).)).))..)))).))))))))))))...........(((((...))))).)))))..((((((....))))))...))))))..)))))))....))))............(((((((((((((..((((((((...(((((((..((.....))..)).))))).............((((((.(((((((((..(((...((((((.((((....((((((.((((....)))).)))....(((((.....)))))..(((........))).((((((.((((..(((((....(((.(((((.(((((..........))))).))..(((((.((((............(((((.........)))))((((((.....(((((((.(((((....((((.(((....(((.....))))))..)))))))))..)))).)))......)))))))))).)))))(((((((...(((((.((...((((....))))...)).)))))...(((......))).(((.............)))((((((.((((((((.......((((((..((............))..))))))...)))))))).))))))......)))))))...)))..)))....)))))....))))))))))...........))).....)))).)))))).)))))))..))))).))))))....))))))))............))))))))))))).))))))...)))).(((((((((((((((((((((((((.....(((((((((.((....(((...((.((((.(........(((((.......)))))).))))))))))).)))))))))....))))..(((((..(((((((((....(((...(((......)))....))).....)))))))))..)))))..(((((((....))..))))).....))))))).)))))........................))))))))))).))).)).)))))))))))).........))))))..................((((......)))).........
Thermodynamic Ensemble Prediction
((((((.(((((..(((.....))).....)))))..(((((.....((((.....)))).......))))}.,,...(({{{(((((((({{.(((.((..((((((...(((((...(((((..(((.........)))..)))))..)))))....)))))).((((..((((((....((((...)))}.((((....(((((((((((((((((((,,{{..{{{.........})}...,||}},...((((((((((((.((((.,,,(.((.(((((...(((((((({((....|||,.........{{.{(((((.{((({.,{((((({{...,}}},}}}},.||||.|||}}}}},))}))),))..(((((((..((((((((...({,..((((((((((..((((.(((..........))).))))...(((((((((...))}.,))))))(((((..((((.....)))).))))){(((..((((...........))))....)))),,(((((((..(((((..........)))))..))))))).,||((((((((.,..........)))))))).,,.}))))).)))).})}..)))))))))))))))))))))))))))).)).}),.)))).)))))))))))).....,,,...{((({...})))}}))))}..((((((....))))))...)))))),.}))))))....)}}}....,,,.....{{{{({(({{((({{|(((((({...{{{((((,,({.....)),.))))}}}}.............((((((.((((({(((...{(,..((((((.((((((((((((((.((((....)))).)))....(((((.....)))))..{{{.{{(({((({,.{{{(,{,{(((((((((((({{..({,(,((.(((((..........))))).)),,}|}||}|((((..{(,.((({{.((((..((((((,....}.)))))}.))))))))),.|||||,...,(({,(({....|||..,.,))))))))))})))))))).))).}})},....)))),))),,{|{||,{((((((...{{{((.((...{(((....)))).,.)).))))).,.(((......))),(((,,,....,,,...)))((((((.((((((((.,.....((((((..((............))..))))))...)))))))).))))))......))))))}.,,....|||,....}},........,..,,.||......,,....)))})..)))).)))))).})}}))}..))))).))))))....}}}))}}},,..,||||....,}}}}))))}}}.))))))...)))).((((((((((((((((((((({(((.,.,,(((((((((.{{..,,,,{....|}||}|,,.......,{|||{....,,,}||}||,,}},}},}}},,))||||}}},|,|}||,..(((((..(((((((((.{{.(((...{((......))}....)}}..,,.)))))))))..)))))...||,,||}},,}},,)))},.....))))))).)))))........................))))))))))).))).)}.)))))))))))).........))))))..................((((......)))).........

Transcripts

ID Sequence Length GC content
GUUCAGGCUGAAGUGUCUUAAUGACUAGAAUUCAGGUUCCAAGGAGAAG… 1758 nt 0.4261
Summary

This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Forensic Context

A study in mice demonstrated that the TINAG was downregulated 11.245-fold at 12 hours post-injury in incised skeletal muscle wounds [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027]. In a separate study in rats, the TINAG was downregulated at 12 hours but upregulated at 48 hours following mild traumatic brain injury [Colak et al. DOI:10.1016/j.injury.2012.01.021]. A study in mice demonstrated that the TINAG was downregulated 11.245-fold at 12 hours post-injury in skeletal muscle incised wounds, as identified through DNA microarray analysis [Mohammed Hassan Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027].